Prevalence and characterization of Staphylococcus aureus in wastewater treatment plants by whole genomic sequencing.

Infections with Staphylococcus aureus are being spread through contact with the community environment, but the role of wastewater treatment plants in the transmission routes is not defined. This study investigated the prevalence, types, genetic elements, and potential for transmission of S. aureus by these engineered systems.

Contribution of cannabis-related cues to concurrent reinforcer choice in humans.

Background: Drug-related cues play a critical role in the development and persistence of substance use disorder. Few human laboratory studies have evaluated how these cues contribute to decisions between concurrently presented reinforcers, and none have examined the specific role of cannabis cues. This study evaluated the contribution of cannabis-related cues to concurrent monetary reinforcer choice in humans.

Predictive value of platelet reactivity unit (PRU) value for thrombotic and hemorrhagic events during flow diversion procedures: a meta-analysis.

Background And Purpose: Platelet function testing prior to flow diversion procedures, although initially heavily debated, has seen a substantial increase in its adoption to assess the risk of operative and perioperative thrombotic and hemorrhagic events. This meta-analysis was conducted to assess platelet function testing, particularly the VerifyNow Platelet Reactivity Unit (PRU) assay, for a relationship between the reported assay PRU value and thrombotic and hemorrhagic events.

Materials And Methods: The currently available literature (2013-2018) was surveyed with PubMed and Google Scholar searches.

Safety Evaluation of Autologous Tissue Vaccine Cancer Immunotherapy in a Canine Model.

Background/aim: Previous work in rodent models showed that an autologous tissue vaccine is both a safe and effective approach for treating cancer; however, as a translational step, safety must first be evaluated in a more clinically-relevant model.

Materials And Methods: An autologous immunotherapy produced from resected tumors, was evaluated in a clinically-relevant canine model to assess safety. Ninety-three dogs with spontaneously occurring tumors received vaccination with inactivated autologous tumor tissue combined with an adjuvant of particulate porcine small intestinal submucosa extracellular matrix (SIS-ECM).

Associations of first trimester co-use of tobacco and Cannabis with prenatal immune response and psychosocial well-being.

Purpose: This study aims to describe the association of first trimester co-use of tobacco and cannabis with maternal immune response and psychosocial well-being, relative to tobacco use only.

Methods: A preliminary midpoint analysis included 138 pregnant women with biologically verified tobacco use, 38 of whom (28%) also tested positive for recent cannabis use. Maternal perceived stress (Perceived Stress Scale), depressive symptoms (Edinburgh Postnatal Depression Scale), and serum immune markers (IL-1β, IL-2, IL-6, IL-8, IL-10, TNFα, CRP, MMP8), were collected, although cytokine data were only available for 122 women.

Evaluating non-medical prescription opioid demand using commodity purchase tasks: test-retest reliability and incremental validity.

Rationale: Non-medical prescription opioid use and opioid use disorder (OUD) present a significant public health concern. Identifying behavioral mechanisms underlying OUD will assist in developing improved prevention and intervention approaches. Behavioral economic demand has been extensively evaluated as a measure of reinforcer valuation for alcohol and cigarettes, whereas prescription opioids have received comparatively little attention.

Influence of phendimetrazine maintenance on the reinforcing, subjective, performance, and physiological effects of intranasal cocaine.

Rationale: No pharmacotherapies are approved for cocaine use disorder. Phendimetrazine, a prodrug of the monoamine-releaser phenmetrazine, attenuates the reinforcing effects of cocaine in preclinical models, has minimal abuse potential, and is safe when combined with cocaine.

Objectives: This study determined the influence of phendimetrazine maintenance on the reinforcing effects of cocaine (i.

Feasibility, Acceptability, and Initial Efficacy of Delivering Alcohol Use Cognitive Interventions via Crowdsourcing.

Background: Inhibitory control training and working memory training are 2 cognitive interventions that have been considered for alcohol use disorder (AUD). Existing studies have typically relied on small samples that preclude the evaluation of small effects. Crowdsourcing is a sampling method that can address these limitations by effectively and efficiently recruiting large samples with varying health histories.

Perceived stress, cytomegalovirus titers, and late-differentiated T and NK cells: Between-, within-person associations in a longitudinal study of older adults.

Cytomegalovirus (CMV) and psychological stress are implicated as drivers of immunological aging. It is unknown, however, whether associations among CMV titers, stress, and immune aging are more stable or dynamic over time. The present investigation tested the between-person (stable differences) and within-person (dynamic fluctuations) associations of CMV titers and perceived stress on late-differentiated T and natural killer (NK) peripheral blood cells in a longitudinal study of older adults aged 64-92 years (N = 149).

A longitudinal study of the stability, variability, and interdependencies among late-differentiated T and NK cell subsets in older adults.

The stability and variability of older adults' late-differentiated peripheral blood T and natural killer (NK) cells over time remains incompletely quantified or understood. We examined the variability and change over time in T and NK cell subsets in a longitudinal sample of older adults; the effects of sex, cytomegalovirus (CMV) serostatus, and chronic disease severity on immune levels and trajectories; and interdependencies among T and NK cell subsets. Older adults (N = 149, age 64-94 years, 42% male) provided blood every 6 months for 2.

Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA-IIA.

The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.

Using behavioral economic variables to predict future alcohol use in a crowdsourced sample.

Background: Theoretical perspectives at the intersection of behavioral economics and operant theory have resulted in numerous advances for addiction science. Three mechanisms (i.e.

World Workshop on Oral Medicine VII: Burning mouth syndrome: A systematic review of disease definitions and diagnostic criteria utilized in randomized clinical trials.

Objective: To conduct a systematic review analyzing disease definitions and diagnostic criteria used in randomized controlled trials (RCTs) involving burning mouth syndrome (BMS).

Methods: A systematic search conducted in PubMed, Web of Science, PsycINFO, Cochrane Database/Cochrane Central, and Google Scholar that included RCTs on BMS published between 1994 and 2017 was performed.

Results: Considerable variability in BMS disease definitions and diagnostic criteria used created substantial heterogeneity in the selection of participants and weakened the rigor of the 36 RCTs identified.

A parent-led intervention to promote recovery following pediatric injury: study protocol for a randomized controlled trial.

Background: Injury is one of the most prevalent potentially emotionally traumatic events that children experience and can lead to persistent impaired physical and emotional health. There is a need for interventions that promote full physical and emotional recovery and that can be easily accessed by all injured children. Based on research evidence regarding post-injury recovery, we created the Cellie Coping Kit for Children with Injury intervention to target key mechanisms of action and refined the intervention based on feedback from children, families, and experts in the field.

VOLLEYBALL OVERHEAD SWING VOLUME AND INJURY FREQUENCY OVER THE COURSE OF A SEASON.

Background: Overuse injuries are common in volleyball; however, few studies exist that quantify the workload of a volleyball athlete in a season. The relationship between workload and shoulder injury has not been extensively studied in women's collegiate volleyball athletes.

Hypothesis/purpose: This study aims to quantify shoulder workloads by counting overhead swings during practice and matches.

A guide for using NIH Image J for single slice cross-sectional area and composition analysis of the thigh from computed tomography.

Reports using computed tomography (CT) to estimate thigh skeletal muscle cross-sectional area and mean muscle attenuation are often difficult to evaluate due to inconsistent methods of quantification and/or poorly described analysis methods. This CT tutorial provides step-by-step instructions in using free, NIH Image J software to quantify both muscle size and composition in the mid-thigh, which was validated against a robust commercially available software, SliceOmatic. CT scans of the mid-thigh were analyzed from 101 healthy individuals aged 65 and older.

Urban Minority Community Safety and its Impact on Physical Activity: The Center for Promoting Health and Health Equity-Racial and Ethnic Approaches to Community Health (CPHHE-REACH) Initiative.

Background/purpose: Daily physical activity is known to improve personal health and well-being and can often be influenced by one's living environment. A qualitative secondary data analysis of a focus group study, performed by the Creighton University Center for Promoting Health and Health Equity (CPHHE) - Racial and Ethnic Approaches to Community Health (REACH), assesses behavioral changes in individuals who participated in newly established physical activities in faith-based organizations, local residential towers, and the local community health center.

Method: Applying thematic analysis within the Health Belief Model framework, the investigators further investigated the relationships between its constructs and levels of physical activity in urban minority neighborhoods.

State laws and policies to reduce opioid-related harm: A qualitative assessment of PDMPs and naloxone programs in ten U.S. States.

As the magnitude of the opioid epidemic grew in recent years, individual states across the United States of America enacted myriad policies to address its complications. We conducted a qualitative examination of the structure, successes, and challenges of enacted state laws and policies aimed at the opioid epidemic, with an in-depth focus on prescription drug monitoring programs (PDMPs) and naloxone access efforts. A set of 10 states (Florida, Kentucky, Massachusetts, Michigan, Missouri, New York, North Carolina, Tennessee, Washington, and West Virginia) was chosen a priori to achieve a varied sample of state policies and timing, as well as population opioid complications.

Culturally relevant risk and protective factors for nonmedical use of prescription opioids among incarcerated African American men.

Background: Recent studies have demonstrated that nonmedical use of prescription opioids (NMUPO) is a national phenomenon affecting a multitude of subpopulations, including incarcerated African American men. However, there has been little investigation of the correlates of NMUPO among this population.

Objective: Grounded in primary socialization theory, the current study aimed to examine the association between family bonds, family history of prescription drug misuse, and mental health symptoms on NMUPO among African American incarcerated men.

Shared heritability and functional enrichment across six solid cancers.

Quantifying the genetic correlation between cancers can provide important insights into the mechanisms driving cancer etiology. Using genome-wide association study summary statistics across six cancer types based on a total of 296,215 cases and 301,319 controls of European ancestry, here we estimate the pair-wise genetic correlations between breast, colorectal, head/neck, lung, ovary and prostate cancer, and between cancers and 38 other diseases. We observed statistically significant genetic correlations between lung and head/neck cancer (r = 0.

Reliability and validity of the Brief DSM-5 Alcohol Use Disorder Diagnostic Assessment: A systematic replication in a crowdsourced sample.

Effectively and efficiently identifying alcohol use disorder (AUD) is an essential goal for researchers and clinicians alike. To date, there are a limited number of self-reported tools specifically designed for evaluating DSM-5 criteria for AUD. The Brief DSM-5 AUD Diagnostic Assessment is a recently created participant self-reported measure with demonstrated reliability and validity in college student populations.

Correction: Genetic data and cognitively defined late-onset Alzheimer's disease subgroups.

This article was originally published under standard licence, but has now been made available under a [CC BY 4.0] license. The PDF and HTML versions of the paper have been modified accordingly.

Effects of multisensory stop signals on alcohol-induced disinhibition in adults with ADHD.

Multisensory environments facilitate behavioral functioning in humans. The redundant signal effect (RSE) refers to the observation that individuals respond more quickly to stimuli when information is presented as multisensory, redundant stimuli (e.g.

Bovine Mammary Gland Biopsy Techniques.

Bovine mammary gland biopsies allow researchers to collect tissue samples to study cell biology including gene expression, histological analysis, signaling pathways, and protein translation. This article describes two techniques for biopsy of the bovine mammary gland (MG). Three healthy Holstein dairy cows were the subjects.