A Novel mutation in the FSH receptor inhibiting signal transduction and causing primary ovarian failure.

Inactivating mutations of the FSH receptor (FSHR) are known to cause ovarian failure with amenorrhea and infertility in women. The first mutation identified in the FSHR gene was a missense mutation (566C-->T, predicting Ala189Val transition) found in several Finnish patients with primary amenorrhea due to ovarian failure. Only five additional, partially or totally inactivating, mutations of the FSHR have been reported.

Towards reliable prenatal diagnosis of mtDNA point mutations: studies of nt8993 mutations in oocytes, fetal tissues, children and adults.

Prenatal diagnosis of mitochondrial DNA (mtDNA) mutations is technically possible, but has only rarely been attempted. This is largely because of uncertainty about the effects of mtDNA heteroplasmy, the mtDNA bottleneck, random segregation or selection of mtDNA species, and difficulty in correlating a particular mtDNA mutant load with clinical outcome. We have investigated the feasibility of prenatal diagnosis for two common mtDNA mutations at nucleotide (nt)8993 by determining mtDNA mutant loads in human oocytes and by reviewing data on 56 pedigrees with these mutations, and by reviewing six studies on mtDNA mutations in human fetuses.

Practical problems in detecting abnormal mitochondrial function and genomes.

Mitochondrial respiratory chain dysfunction causes a wide range of primary diseases in adults and children, with highly variable organ involvement. Diagnosis involves weighing evidence from a number of sources, including the clinical presentation, metabolic measurements in vivo, imaging studies, analysis of respiratory chain function or enzyme activities in vitro, studies of mitochondrial morphology after biopsy, and mitochondrial (mt) DNA mutation analysis. Irrespective of the category of the information, it can be difficult to determine whether abnormal results are due to primary defects of the respiratory chain or to practical problems that complicate the diagnostic methodology.

High frequency hearing loss correlated with mutations in the GJB2 gene.

Genetic hearing impairment affects approximately 1/2000 live births. Mutations in one gene, GJB2, coding for connexin 26 cause 10%-20% of all genetic sensorineural hearing loss. Mutation analysis in the GJB2 gene and audiology were performed on 106 families presenting with at least one child with congenital hearing loss.

Identification of the copper chaperone SAH in Ovis aries: expression analysis and in vitro interaction of SAH with ATP7B.

A clone encoding the putative copper chaperone protein Sheep Atx1 Homologue (SAH) was isolated from a sheep liver cDNA library. The 466-bp cDNA encoded a predicted protein of 68 amino acids, with 44 and 81% amino acid identity to the yeast Atx1 and human Atox1 copper chaperone proteins, respectively. The characteristic MTCxxC and KTGK motifs were conserved in SAH.

Cloning, mapping and expression analysis of the sheep Wilson disease gene homologue.

Copper homeostasis in mammals is maintained by the balance of dietary intake and copper excretion via the bile. Sheep have a variant copper phenotype and do not efficiently excrete copper by this mechanism, often resulting in excessive copper accumulation in the liver. The Wilson disease protein (ATP7B) is a copper transporting P-type ATPase that is responsible for the efflux of hepatic copper into the bile.

Centromerization.

Centromere formation is a complex process that involves the packaging of DNA into a centromere-unique chromatin, chemical modification and the seeding of kinetochore and associated proteins. The early steps in this process, in which a chromosomal region is marked for centromerization (that is, to become resolutely committed to centromere formation), are unusual in that they can apparently occur in a DNA-sequence-independent manner. Current evidence indicates the involvement of epigenetic influences in these early steps.

Chromosome analysis of blastomeres from human embryos by using comparative genomic hybridization.

Karyotypic studies of aborted fetuses have been used to draw the inference that the proportion of conceptuses with chromosome abnormalities is very high. Fluorescent in situ hybridization (FISH) studies of blastomeres from early cleavage embryos have provided some support for this inference but they are limited to the study of a few chromosomes. We describe the novel application of comparative genomic hybridization (CGH) to the study of numerical and structural abnormalities of single blastomeres from disaggregated 3-day-old human embryos.

Assessment of education and counselling offered by a familial colorectal cancer clinic.

We have evaluated whether or not client expectations, in terms of education and information needs, have been met by a multi-disciplinary familial colorectal cancer clinic. The study used a pre- and post-clinic questionnaire design and 126 (84 women, 42 men) clients of the clinic participated. The most common reason for coming to the clinic is to 'find out whether there is a gene for colorectal cancer in the family', followed by 'to reduce risk for bowel cancer' and 'concern for children's risk'.

Early disruption of centromeric chromatin organization in centromere protein A (Cenpa) null mice.

Centromere protein A (Cenpa for mouse, CENP-A for other species) is a histone H3-like protein that is thought to be involved in the nucleosomal packaging of centromeric DNA. Using gene targeting, we have disrupted the mouse Cenpa gene and demonstrated that the gene is essential. Heterozygous mice are healthy and fertile whereas null mutants fail to survive beyond 6.

Uterine dysfunction and genetic modifiers in centromere protein B-deficient mice.

Centromere protein B (CENP-B) binds constitutively to mammalian centromere repeat DNA and is highly conserved between humans and mouse. Cenpb null mice appear normal but have lower body and testis weights. We demonstrate here that testis-weight reduction is seen in male null mice generated on three different genetic backgrounds (denoted R1, W9.

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase.

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms.

Human centromeres and neocentromeres show identical distribution patterns of >20 functionally important kinetochore-associated proteins.

Using combined immunofluorescence and fluorescence in situ hybridization (FISH) analysis we have extensively characterized the proteins associating with two different homologue human neocentromeres at interphase and prometaphase/metaphase, and compared these directly with those found with normal human centromeres. Antisera to CENP-A, CENP-B, CENP-C, CENP-E, CENP-F, INCENP, CLIP-170, dynein, dynactin subunits p150 (Glued) and Arp1, MCAK, Tsg24, p55CDC, HZW10, HBUB1, HBUBR1, BUB3, MAD2, ERK1, 3F3/2, topoisomerase II and a murine HP1 homologue, M31, were used in immuno-fluorescence experiments in conjunction with FISH employing specific DNA probes to clearly identify neocentromeric DNA. We found that except for the total absence of CENP-B binding, neocentromeres are indistinguishable from their alpha satellite-containing counterparts in terms of protein composition and distribution.

Late diagnosis of maternal PKU in a family segregating an arylsulfatase [corrected] E mutation causing symmetrical chondrodysplasia punctata.

Mutations in the arylsulfatase E gene, located on the X chromosome, have been shown to cause chondrodysplasia punctata (CDP). A substitution of arginine with serine at amino acid 12 (R12S) was identified in a patient with typical features of mild symmetrical CDP including mild mental retardation. The proband was institutionalized and was found to have seven full and half siblings all of whom were microcephalic.

Neocentromere formation in a stable ring 1p32-p36.1 chromosome.

Neocentromeres are functional centromeres formed in chromosome regions outside the normal centromere domains and are found in an increasing number of mitotically stable human marker chromosomes in both neoplastic and non-neoplastic cells. We describe here the formation of a neocentromere in a previously undescribed chromosomal region at 1p32-->p36.1 in an oligospermic patient.

Two cases of prenatal analysis for the pathogenic T to G substitution at nucleotide 8993 in mitochondrial DNA.

We report the outcome of two prenatal analyses for the T to G mutation at nucleotide 8993 in the mitochondrial DNA. This mutation is associated with neurogenic muscle weakness, ataxia and retinitis pigmentosa (NARP) and the neurodegenerative condition, Leigh syndrome. One prospective mother was the sister of a severely affected individual, and had previously had an unaffected child and a stillborn child.

Clinical and genetic study of Friedreich ataxia in an Australian population.

Friedreich ataxia is an autosomal recessive disorder caused by mutations in the FRDA gene that encodes a 210-amino acid protein called frataxin. An expansion of a GAA trinucleotide repeat in intron 1 of the gene is present in more than 95% of mutant alleles. Of the 83 people we studied who have mutations in FRDA, 78 are homozygous for an expanded GAA repeat; the other five patients have an expansion in one allele and a point mutation in the other.

Extreme reduction of chromosome-specific alpha-satellite array is unusually common in human chromosome 21.

Human centromeres contain large arrays of alpha-satellite DNA that are thought to provide centromere function. The arrays show size and sequence variation, but the extent to which extremely low levels of this DNA can occur on normal centromeres is unclear. Using a set of chromosome-specific alpha-satellite probes for each of the human chromosomes, we performed interphase fluorescence in situ hybridization (FISH) in a population-screening study.

The Menkes protein (ATP7A; MNK) cycles via the plasma membrane both in basal and elevated extracellular copper using a C-terminal di-leucine endocytic signal.

Menkes disease is an X-linked recessive copper deficiency disorder caused by mutations in the ATP7A ( MNK ) gene which encodes a copper transporting P-type ATPase (MNK). MNK is normally localized pre- dominantly in the trans -Golgi network (TGN); however, when cells are exposed to excessive copper it is rapidly relocalized to the plasma membrane where it functions in copper efflux. In this study, the c-myc epitope was introduced within the loop connecting the first and second transmembrane regions of MNK.

Phenotypic variability of Filipino beta(o)-thalassemia/HbE patients in Indonesia.

Three Indonesian patients with identical genotypes, each compound heterozygotes for Filipino beta(o)-thalassemia/HbE, expressed different clinical severities. One patient has mild disease and is transfusion independent, while the other two are severely affected and transfusion dependent. The size of the Filipino beta(o)-globin gene deletion was confirmed to be 45 kb, resolving conflicting values given in the literature.

Spinal Muscular Atrophies: An Ongoing Diagnostic Dilemma?

Background: Spinal muscular atrophies (SMAs) are a group of autosomal recessive disorders of anterior horn cell degeneration. Three genes-survival motor neuron (SMN), neuronal apoptosis inhibitory protein (NAIP), and, more recently, p44 (subunit of basal transcription factor II)-have been considered as candidate genes. The region spanning these genes has a complex organization, which makes molecular analysis difficult.

Conservation of centromere protein in vertebrates.

The chicken genome comprises 78 chromosomes which include several macrochromosomes and many microchromosomes. Very little information is currently available concerning chicken centromere structure and function and it is unclear if the two types of chromosomes share a common centromere mechanism or whether this mechanism resembles those in other species. Immunofluorescence studies using antibodies to mammalian constitutive centromere proteins CENP-A, CENP-B, and CENP-C and the passenger proteins CENP-E, and CENP-F revealed the presence of each of these proteins at the centromeres of both macro- and microchromsomes.

Cloning and expression analysis of the sheep ceruloplasmin cDNA.

The cDNA encoding sheep ceruloplasmin (sCP) was isolated from a sheep liver cDNA library. The cDNA contig was 3530 nucleotides in length and encoded a protein of 1048 amino acids. The deduced amino acid sequence showed a high degree of conservation (87%) when compared to the human ceruloplasmin (hCP) sequence.