The efficacy of intracerebroventricular idursulfase-beta enzyme replacement therapy in mucopolysaccharidosis II murine model: heparan sulfate in cerebrospinal fluid as a clinical biomarker of neuropathology.

Mucopolysaccharidosis II (MPS II) is caused by a deficiency of iduronate-2-sulfatase that results in accumulation of glycosaminoglycans (GAG), including heparan sulfate (HS), which is considered to contribute to neuropathology. We examined the efficacy of intracerebroventricular (ICV) enzyme replacement therapy (ERT) of idursulfase-beta (IDS-β) and evaluated the usefulness of HS as a biomarker for neuropathology in MPS II mice. We first examined the efficacy of three different doses (3, 10, and 30 μg) of single ICV injections of IDS-β in MPS II mice.

BGN Mutations in X-Linked Spondyloepimetaphyseal Dysplasia.

Spondyloepimetaphyseal dysplasias (SEMDs) comprise a heterogeneous group of autosomal-dominant and autosomal-recessive disorders. An apparent X-linked recessive (XLR) form of SEMD in a single Italian family was previously reported. We have been able to restudy this family together with a second family from Korea by segregating a severe SEMD in an X-linked pattern.

AAV8-mediated expression of N-acetylglucosamine-1-phosphate transferase attenuates bone loss in a mouse model of mucolipidosis II.

Mucolipidoses II and III (ML II and ML III) are lysosomal disorders in which the mannose 6-phosphate recognition marker is absent from lysosomal hydrolases and other glycoproteins due to mutations in GNPTAB, which encodes two of three subunits of the heterohexameric enzyme, N-acetylglucosamine-1-phosphotransferase. Both disorders are caused by the same gene, but ML II represents the more severe phenotype. Bone manifestations of ML II include hip dysplasia, scoliosis, rickets and osteogenesis imperfecta.

Improvement of cardiac function by short-term enzyme replacement therapy in a murine model of cardiomyopathy associated with Hunter syndrome evaluated by serial echocardiography with speckle tracking 2-D strain analysis.

Cardiac systolic function is significantly decreased in a proportion of patients with Hunter syndrome. This study was performed to evaluate the change in myocardial function associated with enzyme replacement therapy (ERT) in a mouse model of cardiomyopathy associated with Hunter syndrome. Thirty 9-week-old iduronate-2-sulfatase (IDS) knockout mice received either intravenous injection of human recombinant IDS (ERT group, N=15) or saline (control group, N=15) for 5 weeks.

Structural and binding properties of two paralogous fatty acid binding proteins of Taenia solium metacestode.

Background: Fatty acid (FA) binding proteins (FABPs) of helminths are implicated in acquisition and utilization of host-derived hydrophobic substances, as well as in signaling and cellular interactions. We previously demonstrated that secretory hydrophobic ligand binding proteins (HLBPs) of Taenia solium metacestode (TsM), a causative agent of neurocysticercosis (NC), shuttle FAs in the surrounding host tissues and inwardly transport the FAs across the parasite syncytial membrane. However, the protein molecules responsible for the intracellular trafficking and assimilation of FAs have remained elusive.

Paralogous proteins comprising the 150 kDa hydrophobic-ligand-binding-protein complex of the Taenia solium metacestode have evolved non-overlapped binding affinities toward fatty acid analogs.

We previously identified a hydrophobic-ligand-binding protein (HLBP) of the Taenia solium metacestode (TsM), which might be involved in the uptake of fatty acids (FAs) from host environments. The TsM 150kDa HLBP was a hetero-oligomeric complex composed of multiple 7kDa (RS1) and 10kDa (CyDA, b1 and m13h) subunits, and displayed a wide spectrum of binding affinities toward various FA analogs. In this study, we analysed biochemical properties and phylogenetic relationships of the individual subunits.

Identification and biochemical characterization of two novel peroxiredoxins in a liver fluke, Clonorchis sinensis.

We identified 2 novel genes encoding different 2-Cys peroxiredoxins (PRxs), designated CsPRx2 and CsPRx3, in Clonorchis sinensis, which invades the human hepatobiliary tracts. The CsPRx2 gene expression was temporally increased along with the parasite's development and its protein product was detected in almost all parts of adult worms including subtegument, as well as excretory-secretory products. Conversely, CsPRx3 expression was temporally maintained at a basal level and largely restricted within interior parts of various tissues/organs.

A novel sigma-like glutathione transferase of Taenia solium metacestode.

GSTs are a group of multifunctional enzymes, whose major functions involve catalysis of conjugation of glutathione thiolate anion with a multitude of bi-substrates or transportation of a range of hydrophobic ligands. Helminth GSTs are intimately involved in the scavenging of endogenously/exogenously-derived toxic compounds and xenobiotics. In this study, we identified a novel GST gene of Taenia solium metacestodes (TsMs), which is a causative agent of neurocysticercosis.

Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations.

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T), and 3 missense mutations (353C>A, 779T>C, 899G>T).

Morphologic evaluation and integrin expression profile of renal tubular cells cultured from percutaneous renal biopsy specimen.

Kidney biopsy is an indispensible procedure for making a pathologic diagnosis of renal diseases by fixing and staining the biopsy specimen. However, it is not a routine procedure to culture the cells from a renal biopsy specimen directly, or to utilize the cultured cells for any kind of diagnostic or functional evaluation. In this study, primary culture of the renal tubular epithelial cells was tried from a piece of percutaneous kidney biopsy specimen.