7 results match your criteria: "Okayama University Graduated School of Medicine[Affiliation]"
Biol Pharm Bull
August 2014
Department of Immunobiology, Okayama University Graduated School of Medicine, Dentistry, and Pharmaceutical Sciences.
Mast cells are involved in various immunological responses, although it remains unknown how their terminal differentiation is regulated. We previously established a culture model that mimics the process of mast cell maturation in the cutaneous tissue and found that growth factor independent 1 (Gfi1) was up-regulated whereas its paralogue Gfi1b down-regulated. Here we investigated the roles of Gfi1 and Gfi1b in the process of mast cell maturation using a murine mast cell line, MC9.
View Article and Find Full Text PDFCirc J
May 2009
Department of Cardiovascular Medicine, Okayama University Graduated School of Medicine, Density and Pharmaceutical Science, Japan.
Background: Some supraventricular tachycardias could be ablated from the non-coronary sinus of Valsalva (NSV). However, the characteristics of the NSV electrograms have not been clarified.
Methods And Results: A quantitative analysis of the NSV electrograms was performed in 5 patients with tachycardias arising from near the atrioventricular node (AVN) and the His-bundle region, and in 20 control subjects.
J Bone Miner Metab
March 2009
Department of Pediatrics, Okayama University Graduated School of Medicine and Dentistry, 2-5-1, Shikata-cho, Okayama 700-8558, Japan.
Circ J
August 2007
Division of Cardiology, Gunma Prefectural Cardiovascular Center, Maebashi, and Department of Cardiovascular Medicine, Okayama University Graduated School of Medicine, Density and Pharmaceutical Science, Japan.
Background: Bepridil has multiple ion-channel blocking effects and is expected to be useful for managing atrial fibrillation (AF). The purpose of this study was to clarify the efficacy and safety of additional treatment with bepridil in patients with AF who had been treated with class I antiarrhythmic drugs (AADs).
Methods And Results: Bepridil (50-200 mg/day) was given to 76 patients with either paroxysmal (n=49) or persistent AF (n=27).
Placenta
April 2007
Department of Obstetrics and Gynecology, Okayama University Graduated School of Medicine, Dentistry and Pharmaceutical Sciences, 2-5-1 Shikata, Okayama 700-8558, Japan.
Peroxisome proliferator-activated receptor gamma (PPARgamma) is expressed predominantly in adipose tissue and is known to be involved in adipocyte differentiation and insulin sensitivity. Recent reports indicated that PPARgamma-deficient mice were embryonic lethal due to abnormal placental development, suggesting that PPARgamma plays an important role in normal development of placenta. On the other hand, expression of vascular endothelial growth factor (VEGF), the other important factor in placental development, has been demonstrated to be regulated by PPARgamma in vascular smooth muscle cells.
View Article and Find Full Text PDFBone
February 2005
Department of Pediatrics, Okayama University Graduated School of Medicine and Dentistry, Okayama 700-8558, Japan.
Cartilage-hair hypoplasia (CHH) is an autosomal recessive metaphyseal chondrodysplasia characterized by severe short-limb short stature and hypoplastic hair. The responsible gene for CHH has been identified to be ribonuclease of mitochondrial RNA-processing (RMRP) gene. We examined RMRP genes of a 3-year-old Japanese CHH boy and his family and revealed a novel mutation: 20 bp duplication (TACTCTGTGAAGCTGAGGAC), in promoter region of maternal allele, at nucleotide -3 and a reported 218A>G point mutation in transcribed region of paternal allele.
View Article and Find Full Text PDFJ Clin Immunol
May 2003
Department of Medicine and Medical Sciences, Okayama University Graduated School of Medicine and Dentistry, Okayama, Japan.
We analyzed the prevalence and longitudinal fluctuation of hepatitis B virus (HBV)-specific CD8 T cells in chronic HBV infection using an HLA-A2-HBc18-27 tetramer. Thirty-five HLA-A2-positive patients with chronic HBV infection were divided into 17 HBe antigen (HBeAg)-positive and 18 anti-HBe antibody (anti-HBe)-positive patients. Five HLA-A2-positive normal subjects, five HLA-A2-negative patients with chronic HBV infection, and two HLA-A2-positive patients with acute HBV infection were included as controls.
View Article and Find Full Text PDF