Seedling and Adult Plant Resistance to Powdery Mildew in Chinese Bread Wheat Cultivars and Lines.

Powdery mildew, caused by Blumeria graminis f. sp. tritici, is a widespread wheat disease in China.

[A comprehensive quantitative assessment model for arid area's basin water-soil environment quality].

The existing assessment models for water-soil environment quality are usually established on the relationships between assessment indicators and their assessment criteria. Such kinds of models are varied with regional scale, and always need a mass of calculation work. This paper tried to find a general assessment model based on a given water-soil quality assessment criteria.

[Productivity of crop-fruit ecological agriculture in middle-south Loess Plateau].

With the Xipo, Feimahe and Nangou villages as test objects, the productive characteristics of crop-fruit ecological agriculture in the middle-south Loess Plateau were investigated. The results showed that the biomass productivity of a plant was different with its organs, the highest for grain or fruit, and followed by stem, leaf and root. In the crop-fruit ecological agriculture, the higher ratio the crop subsystem, the higher productivity its biomass, the lower economic productivity and lower economic value was; while the fruit subsystem was on the contrary.

[Simulation of nitrogen mineralization and immobilization of crop straw during its initial decomposition in soil].

The nitrogen (N) transformation of crop straw during its initial decomposition in soil was simulated by Model-maker software. A good fit was obtained between the simulated and measured data of 6 variables, including the amount of soil ammonium N, nitrate N, microbial biomass N and their 15N atom %. The simulation results indicated that the main N form immobilized by soil microbes was ammonium, while the immobilization of nitrate was very small.

[Spatial distribution pattern of Larix chinensis population in Taibai Mt].

Larix chinensis is an endangered species only distributed in Qinling Mountains of China. It has a concentrated distribution in Taibai Mt., and plays an important role in environmental protection in the high altitude.

[Nuclear transfer and therapeutic cloning].

Nuclear transfer and therapeutic cloning have widespread and attractive prospects in animal agriculture and biomedical applications. We reviewed that the quality of oocytes and nuclear reprogramming of somatic donor cells were the main reasons of the common abnormalities in cloned animals and the low efficiency of cloning and showed the problems and outlets in therapeutic cloning, such as some basic problems in nuclear transfer affected clinical applications of therapeutic cloning. Study on isolation and culture of nuclear transfer embryonic stem (ntES) cells and specific differentiation of ntES cells into important functional cells should be emphasized and could enhance the efficiency.

[Effects of root exudates of squash grafted with cucumber shoot on seed germination].

Cucumber (Cucumis statirus L.) is commonly cultivated by grafting on squash (Cucurbita moschata) in commercial production. The effects of root exudates of squash grafted with cucumber on seed germination rate of cucumber and squash were tested.

[Developmental capacity of reconstructed embryos by transfer with peripheral blood lymphocytes in mouse].

Mouse peripheral blood lymphocytes were used as donor nuclei in nuclear transfer procedures to determine their feasibility. Lymphocytes were collected from peripheral blood by lymphocyte isolation liquid (density 1.088), and transferred into enucleated oocytes by intracytoplasmic injection.

[Genetic structure and phylogeny status of Chaidamu goat population].

Genetic structure and character of Chaidamu goats were studied through simple random sampling. Genetic structure was analysed from five aspects, and phylogeny status was also investigated. The results indicated that: (1) the average phenotypic heterogeneity degree of coat color and morphological character were 0.

[The growth of Salvia miltiorrhiza seedling and root system following transplantation].

Objective: To study the relationship between plant growth and accumulation of active ingredients in Salvia miltiorrhiza.

Method: Transplants of S. miltiorrhiza were sampled at 20 day intervals.

[Investigation on extraction conditions of tebufenozide residue from cabbage using supercritical fluid extraction].

An extraction method of tebufenozide using supercritical fluid extraction (SFE) and high performance liquid chromatography (HPLC) was developed. The selected conditions were 48.3 MPa (7000 psi), 60 degrees C, 20 min of static time, dynamic extraction with 10 mL of CO2, 0.

Development of primers specific for LMW-GS genes located on chromosome 1D and molecular characterization of a gene from Glu-D3 complex locus in bread wheat.

Glutenins are multimeric aggregates of high molecular weight (HMW) and low molecular weight (LMW) subunits, which determine the quality in wheat. Development of locus-specific primers is an important step toward cloning specific LMW glutenin subunits (LMW-GS) by PCR method. Based on the publicly available, a pair of primer, namely primer 3 (5' TTGTAGAAACTGCCATCCTT 3') and primer 4 (5' GTCACCGCTGCAT CGACATA 3') was designed and verified to specific for LMW-GS genes located on chromosome 1D in this study.

[Demecolcine-induced enucleation of Kunming mouse oocyte].

On the basis of exiting technique pathway of demecolcine-induced enucleation(IE), several factors (Demecolcine concentration, time of demecolcine inition and treatment, oocytes age) affecting the IE rate were tested using Kunming mouse oocytes. The experiments' results demonstrated that: In experiment 1,activated oocytes could be enucleated efficiently by treating with KSOM medium containing 0.4 microg/mL or 0.

[Genetic effect of the marker assisted selection on economic traits of goats].

The genetic relationships between economic traits and genetic markers were studied in 147 goats including Chaidamu goat (CS), Chaidamu Cashmere goat (CRS) and Liaoning Cashmere goat (LRS) in Qinghai province, China. CRS was the population of CSxLRS crossbred. The results showed as follows: the selection reaction of these blood protein polymorphisic loci were great, such as EsD, LAP and P(A-3); and EsD2-2, LAPBB and PA-32-2 were the superior marker genotypes on body weight ,Cashmere yield and Cashmere fineness respectively by Least Square method.

[The discovery of a novel flower color mutation in male sterile rapeseed ( Brassica napus L. )].

The author found a novel yellow-white flower color mutation in the male sterile progenies derived from a commercial Brassica.napus hybrid C022, which was produced by a male sterility line 9012A, whose sterility was controlled by interaction between two pairs recessive genes and a pair of epitatic genes. The mutant was named 991S.

[Polymorphisms of insulin-like growth factor binding protein 3 gene and its associations with several carcass traits in Qinchuan cattle].

DNA samples from 60 Qinchuan cattle (Bos taurus) were analyzed with PCR-RFLPs and sequencing for insulin-like growth factor binding protein 3 (IGFBP3) gene. Fragments of 651 bp were amplified with two primers and the products of PCR were digested with restriction endonuclease HaeIII. The produced fragments showed three genotypes, namely AA,AB and BB after electrophoresis.

[Genetic co-adaptability among structural genes under the condition of genetic disequilibrium].

With the technology of PAGE,the genetic polymorphism of blood protein and enzyme was investigated,and genetic co-adaptability among structural genes was studied in three goat populations(147 goats) including Chaidamu goat(CS), Chaidamu Cashmere goat(CRS) and Liaoning Cashmere goat(LRS) in Qinghai Province, China. The results were showed that the genetic disequilibrium of 10 locus combinations was found among 45 locus combinations in the three goat populations,and these genetic disequilibria were caused only by the difference of genetic co-adaptability among genes,because there didn't exist the linkage disequilibrium among non-allelic genes. The genetic disequilibrium including the difference of genetic co-adaptability between non-allelic genes was only found at Tf-P(A-3) locus combinations in LRS population,the other ones were all caused by the genetic disequilibrium at a single locus.

[Study on configuration fabric and germinative conditions of Salvia miltiorrhizy seeds].

Objective: To provide theoretic warrant and technical reference for Salvia miltiorrhizr standardization planting, by carrying out various systemic studies such as observation of seeds configuration fabric, idiosyncrasy of water absorption and groping germinating conditions.

Method: In the study of configuration fabric, seeds were observed and taken photos by scanning electronic microscope, and heft method was used for measuring changes of water absorption velocity and dehydration velocity. Seeds germination conditions were probed into under the national test regulations for crop seeds and related prescription from international standards.

Genetic distances revealed by morphological characters, isozymes, proteins and RAPD markers and their relationships with hybrid performance in oilseed rape (Brassica napus L.).

Genetic distances (GDs) based on morphological characters, isozymes and storage proteins, and random amplified polymorphic DNAs (RAPD) were used to predict the performance and heterosis of crosses in oilseed rape (Brassica napus L.). Six male-sterile lines carrying the widely used Shaan2A cytoplasm were crossed with five restorer lines to produce 30 F1 hybrids.

[Identification of wheat and barley hybrid offspring by GISH and PAGE].

Genomic in situ hybridization (GISH) and polyacrylamide gel electrophoresis (PAGE) of wheat seed were used to identify the barley chromosome in offspring of wheat and barley hybrid. A sires of alien addition lines, alien substitution lines and translocation lines were detected by GISH. WBA984 and WBA9812 were alien addition lines, WBS0215 and WBS0264 were alien substitution lines,and WBT02125 and WBT02183 were translocation lines in chromosome terminal.

[Study on mitochondrial DNA genetic diversity of some cattle breeds in China].

The complete mitochondrial D-loop sequences, 910 bp in length, in 22 individuals from 8 cattle breeds in China were analyzed. The results showed that A% + T% was about 61.65%.

[Research advance in application of heat technique in studying stem sap flow].

This paper reviewed the principles of heat technique and its application in studying stem sap flow. Heat technique combined with determinations of tree physiological items such as whole-tree hydraulic conductance, stomatal conductance, water potential, and stem water storage can make us deeply analyze the regulation mechanism of tree transpiration, and approach the effect of environmental conditions on stem sap flow and its response. In addition, this technique can be also used for a long-term measurement of the hydrological characters of zonal forest stands, which will give a powerful technical support in properly assessing the hydrological effect of forest.

[Niche characteristics of plant populations in Quercus aliena var. acuteserrata stands in Qinling Mountains].

Based on the data collected from 31 plots and using Levins, Hurlbert and Pianka formulas, this paper calculated and analyzed the niche breadths and overlaps of 24 tree and 29 shrub populations in Quercus aliena var. acuteserrata stands in Mt. Qinling, Shaanxi.

Molecular species of ceramides from the ascomycete truffle Tuber indicum.

The ceramide fractions were isolated from the chloroform/methanolic extractable of the fruiting bodies of Tuber indicum and separated into three kinds of molecular species TI-1, TI-2, and TI-3 by normal and reverse phase silica gel-column chromatography. By means of (1)H NMR and (13)C NMR spectroscopy, fast atom bombardment mass spectrometry (FAB-MS), and chemical degradation experiment, their component sphingoid base for TI-1 and TI-2 was uniformly (2S,3S,4R)-2-amino-1,3,4-octadecantriol, while the sphingoid of TI-3 was d-erythro-sphingosine, and their structures have been determined unequivocally to be (2S,2'R,3S,4R)-2-(2'-d-hydroxyalkanoylamino) octadecane-1,3,4-triol, the fatty acid composition of which consists of 2-hydroxydocosanoic, 2-hydroxytetracosanoic, and 2-hydroxytricosanoic acids (from major to minor); (2S,3S,4R)-2-(alkanoylamino)octadecane-1,3,4-triol, the fatty acid composition of which is unusual and consists of docosanoic, hexadecanoic, tricosanoic, octadecanoic and nonadecanoic acids (from major to minor); and (2S,3R,4E)-2-(alkanoylamino)-4-octadecene-1,3-diol, the component fatty acids of which were hexadecanoic (predominant) and octadecanoic acids, respectively.