Friedreich ataxia: an overview.

Friedreich ataxia, an autosomal recessive neurodegenerative disease, is the most common of the inherited ataxias. The recent discovery of the gene that is mutated in this condition, FRDA, has led to rapid advances in the understanding of the pathogenesis of Friedreich ataxia. About 98% of mutant alleles have an expansion of a GAA trinucleotide repeat in intron 1 of the gene.

Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase.

A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms.

Human centromeres and neocentromeres show identical distribution patterns of >20 functionally important kinetochore-associated proteins.

Using combined immunofluorescence and fluorescence in situ hybridization (FISH) analysis we have extensively characterized the proteins associating with two different homologue human neocentromeres at interphase and prometaphase/metaphase, and compared these directly with those found with normal human centromeres. Antisera to CENP-A, CENP-B, CENP-C, CENP-E, CENP-F, INCENP, CLIP-170, dynein, dynactin subunits p150 (Glued) and Arp1, MCAK, Tsg24, p55CDC, HZW10, HBUB1, HBUBR1, BUB3, MAD2, ERK1, 3F3/2, topoisomerase II and a murine HP1 homologue, M31, were used in immuno-fluorescence experiments in conjunction with FISH employing specific DNA probes to clearly identify neocentromeric DNA. We found that except for the total absence of CENP-B binding, neocentromeres are indistinguishable from their alpha satellite-containing counterparts in terms of protein composition and distribution.

Late diagnosis of maternal PKU in a family segregating an arylsulfatase [corrected] E mutation causing symmetrical chondrodysplasia punctata.

Mutations in the arylsulfatase E gene, located on the X chromosome, have been shown to cause chondrodysplasia punctata (CDP). A substitution of arginine with serine at amino acid 12 (R12S) was identified in a patient with typical features of mild symmetrical CDP including mild mental retardation. The proband was institutionalized and was found to have seven full and half siblings all of whom were microcephalic.

Mitochondrial DNA mutations at nucleotide 8993 show a lack of tissue- or age-related variation.

Two pathogenic mitochondrial DNA mutations, a T-to-G substitution (8993T > G) and a T-to-C substitution (8993T > C), at nucleotide 8993 have been reported. We describe 13 pedigrees with mitochondrial DNA mutations at nucleotide 8993; 10 pedigrees with the 8993T > G mutation and three with the 8993T > C mutation. Prenatal diagnosis of the nucleotide 8993 mutations is technically possible.

Analyses of the COGA data set in one ethnic group with examinations of alternative definitions of alcoholism.

We used GENEHUNTER and GENEHUNTER-PLUS to search for linkage with the markers in the Collaborative Study on the Genetics of Alcoholism (COGA) data set in a single ethnic group. Analyses of a complex disorder such as alcoholism depend on the definition of affection status. The COGA study provides two definitions of alcoholism (variables ALDX1 and ALDX2).

Neocentromere formation in a stable ring 1p32-p36.1 chromosome.

Neocentromeres are functional centromeres formed in chromosome regions outside the normal centromere domains and are found in an increasing number of mitotically stable human marker chromosomes in both neoplastic and non-neoplastic cells. We describe here the formation of a neocentromere in a previously undescribed chromosomal region at 1p32-->p36.1 in an oligospermic patient.

The new genetics. What are the everyday clinical applications?

Background: Our understanding of human genetics has changed exponentially in recent years, but genetic research is sometimes perceived as an esoteric and expensive pursuit with few practical implications for the majority of the population. As the human genome project nears completion, we need to assess how we can use this vast knowledge effectively.

Objective: To focus on the role of new genetics in the understanding of both single gene disorders and the inheritance of complex traits (which have genetic and environmental components) and to discuss the role of the general practitioner (GP) utilising this knowledge in daily practice.

Two cases of prenatal analysis for the pathogenic T to G substitution at nucleotide 8993 in mitochondrial DNA.

We report the outcome of two prenatal analyses for the T to G mutation at nucleotide 8993 in the mitochondrial DNA. This mutation is associated with neurogenic muscle weakness, ataxia and retinitis pigmentosa (NARP) and the neurodegenerative condition, Leigh syndrome. One prospective mother was the sister of a severely affected individual, and had previously had an unaffected child and a stillborn child.

Identifying genes predisposing to atopic eczema.

Background: Genetic and environmental factors are known to play a role in the development of atopic diseases, such as asthma, eczema, and rhinitis. However, the atopy gene (or genes) has yet to be defined. Studies of familial asthma have identified several regions that may contain genes predisposing to atopy, but the data for candidate regions do not show agreement, which may be due to heterogeneity, ascertainment bias, or stochastic factors.

Detection of an appropriate kinase activity in branchial arches I and II that coincides with peak expression of the Treacher Collins syndrome gene product, treacle.

Treacher Collins syndrome (TCS) is an autosomal dominant craniofacial disorder involving the mid and lower face and, in particular, the tissues affected arise solely from embryonic branchial arches I and II. TCOF1, the gene involved in TCS, has been cloned and although the function of the encoded protein, treacle, has not yet been established, it exhibits peak expression in the branchial arches. Treacle contains a series of repeating units of acidic and basic residues, which are predicted to contain putative casein kinase II (CKII) and protein kinase C (PKC) phosphorylation site motifs.

G130V, a common FRDA point mutation, appears to have arisen from a common founder.

Friedreich ataxia (FRDA) is the most common inherited ataxia. About 98% of mutant alleles have an expansion of a GAA trinucleotide repeat in intron 1 of the affected gene, FRDA. The other 2% are point mutations.

Evaluating ethics competence in medical education.

We critically evaluate the ways in which competence in medical ethics has been evaluated. We report the initial stage in the development of a relevant, reliable and valid instrument to evaluate core critical thinking skills in medical ethics. This instrument can be used to evaluate the impact of medical ethics education programmes and to assess whether medical students have achieved a satisfactory level of performance of core skills and knowledge in medical ethics, within and across institutions.

Clinical and genetic study of Friedreich ataxia in an Australian population.

Friedreich ataxia is an autosomal recessive disorder caused by mutations in the FRDA gene that encodes a 210-amino acid protein called frataxin. An expansion of a GAA trinucleotide repeat in intron 1 of the gene is present in more than 95% of mutant alleles. Of the 83 people we studied who have mutations in FRDA, 78 are homozygous for an expanded GAA repeat; the other five patients have an expansion in one allele and a point mutation in the other.

Extreme reduction of chromosome-specific alpha-satellite array is unusually common in human chromosome 21.

Human centromeres contain large arrays of alpha-satellite DNA that are thought to provide centromere function. The arrays show size and sequence variation, but the extent to which extremely low levels of this DNA can occur on normal centromeres is unclear. Using a set of chromosome-specific alpha-satellite probes for each of the human chromosomes, we performed interphase fluorescence in situ hybridization (FISH) in a population-screening study.

Detection of aneuploidy in single cells using comparative genomic hybridization.

The ability of comparative genomic hybridization (CGH) to detect aneuploidy following universal amplification of DNA from a single cell, or a small number of cells, was investigated with a view to preimplantation diagnosis following in vitro fertilization, and prenatal diagnosis using fetal erythroblasts obtained from maternal blood. The DNA obtained from lysed single cells was amplified using degenerate oligonucleotide-primed PCR (DOP-PCR). This product was labelled using nick translation and hybridized together with normal reference genomic DNA.

The Menkes protein (ATP7A; MNK) cycles via the plasma membrane both in basal and elevated extracellular copper using a C-terminal di-leucine endocytic signal.

Menkes disease is an X-linked recessive copper deficiency disorder caused by mutations in the ATP7A ( MNK ) gene which encodes a copper transporting P-type ATPase (MNK). MNK is normally localized pre- dominantly in the trans -Golgi network (TGN); however, when cells are exposed to excessive copper it is rapidly relocalized to the plasma membrane where it functions in copper efflux. In this study, the c-myc epitope was introduced within the loop connecting the first and second transmembrane regions of MNK.

Phenotypic variability of Filipino beta(o)-thalassemia/HbE patients in Indonesia.

Three Indonesian patients with identical genotypes, each compound heterozygotes for Filipino beta(o)-thalassemia/HbE, expressed different clinical severities. One patient has mild disease and is transfusion independent, while the other two are severely affected and transfusion dependent. The size of the Filipino beta(o)-globin gene deletion was confirmed to be 45 kb, resolving conflicting values given in the literature.

Spinal Muscular Atrophies: An Ongoing Diagnostic Dilemma?

Background: Spinal muscular atrophies (SMAs) are a group of autosomal recessive disorders of anterior horn cell degeneration. Three genes-survival motor neuron (SMN), neuronal apoptosis inhibitory protein (NAIP), and, more recently, p44 (subunit of basal transcription factor II)-have been considered as candidate genes. The region spanning these genes has a complex organization, which makes molecular analysis difficult.

Conservation of centromere protein in vertebrates.

The chicken genome comprises 78 chromosomes which include several macrochromosomes and many microchromosomes. Very little information is currently available concerning chicken centromere structure and function and it is unclear if the two types of chromosomes share a common centromere mechanism or whether this mechanism resembles those in other species. Immunofluorescence studies using antibodies to mammalian constitutive centromere proteins CENP-A, CENP-B, and CENP-C and the passenger proteins CENP-E, and CENP-F revealed the presence of each of these proteins at the centromeres of both macro- and microchromsomes.

Cloning and expression analysis of the sheep ceruloplasmin cDNA.

The cDNA encoding sheep ceruloplasmin (sCP) was isolated from a sheep liver cDNA library. The cDNA contig was 3530 nucleotides in length and encoded a protein of 1048 amino acids. The deduced amino acid sequence showed a high degree of conservation (87%) when compared to the human ceruloplasmin (hCP) sequence.

A paraxial exclusion zone creates patterned cranial neural crest cell outgrowth adjacent to rhombomeres 3 and 5.

Cranial neural crest cell migration is patterned, with neural crest cell-free zones adjacent to rhombomere (R) 3 and R5. These zones have been suggested to result from death of premigratory neural crest cells via upregulation of BMP-4 and Msx-2 in R3 and R5, consequent to R2-, R4-, and R6-derived signals. We reinvestigated this model and found that cell death detected by acridine orange staining in avian embryos varied widely numerically and in pattern, but with a tendency for an elevated zone centered at the R2/3 boundary.

Efficient and precise engineering of a 200 kb beta-globin human/bacterial artificial chromosome in E. coli DH10B using an inducible homologous recombination system.

Gene therapy studies require techniques that allow alteration of human genomic DNA sequences. Bacterial artificial chromosome cloning systems (BACs/PACs) bridge the gap between vectors with small inserts and yeast artificial chromosomes (YACs). We report the use of a second generation BAC vector, pEBAC, containing eukaryotic selectable markers and combining some of the best features of the BAC, PAC and HAEC systems, into which a 185 kb sequence containing the human beta-globin gene cluster was retrofitted.