Human umbilical mesenchymal stem cells ameliorate atrophic gastritis in aging mice by participating in mitochondrial autophagy through Ndufs8 signaling.

Background: Chronic atrophic gastritis (CAG) is a chronic disease of the gastric mucosa characterized by a reduction or an absolute disappearance of the original gastric glands, possibly replaced by pseudopyloric fibrosis, intestinal metaplasia, or fibrosis. CAG develops progressively into intestinal epithelial metaplasia, dysplasia, and ultimately, gastric cancer. Epidemiological statistics have revealed a positive correlation between the incidence of CAG and age.

Serum galectin-3 can help distinguish lupus nephritis from systemic lupus erythematosus and is also correlated with the degree of renal damage in lupus nephritis.

Lupus nephritis (LN) constitutes a substantial contributor to morbidity and mortality in systemic lupus erythematosus (SLE). The monitoring of renal function in patients with LN is associated with improved prognostication. The objective of this study was to evaluate the clinical utility of serum galectin-3 (Gal-3) levels in differentiating LN from SLE.

[The level of thyroid stimulating hormones in different gender and age and the association with the risk of coronary heart disease in cohort population].

To analyze the thyroid stimulating hormone (TSH) levels in different genders and ages, and the association between TSH level and the risk of coronary heart disease. The baseline survey was conducted using a multi-stage cluster random sampling method from September to December 2015, in Jurong City, Jiangsu Province. A total of 10 703 participants were included in the analysis.

Identification of lipid metabolism-related biomarkers and prognostic analysis in geriatric patients with sepsis.

Introduction: This study aimed to find the lipid metabolism-associated biomarkers in geriatric patients with sepsis.

Methodology: The gene expression profiles of specimens from geriatric patients with sepsis were retrieved from the Gene Expression Omnibus database. Differentially expressed genes were obtained via "limma" R package, and modules and genes highly associated with geriatric patients with sepsis were screened via "WGCNA" R package.

A Nomogram for Predicting Recurrence in Stage I Non-Small Cell Lung Cancer.

Background: Early-stage non-small cell lung cancer (NSCLC) is being diagnosed increasingly, and in 30% of diagnosed patients, recurrence will develop within 5 years. Thus, it is urgent to identify recurrence-related markers to optimize the management of patient-tailored therapeutics.

Methods: The eligible datasets were downloaded from TCGA and GEO.

The gut microbiome, chronic kidney disease, and sarcopenia.

Sarcopenia is a prevalent condition in patients with chronic kidney disease (CKD), intricately linked to adverse prognoses, heightened cardiovascular risks, and increased mortality rates. Extensive studies have found a close and complex association between gut microbiota, kidney and muscle. On one front, patients with CKD manifest disturbances in gut microbiota and alterations in serum metabolites.

Personality Traits and Quality of Life Among Older Adults: The Chain Mediating Effects of Perceived Social Support and Positive Coping Styles.

The pathways between personality traits and older adults' quality of life (QOL) have been well studied. However, perceived social support and positive coping styles should not be ignored by older adults' QOL. Hence, this study examines the chain mediating role of perceived social support and positive coping styles between personality traits and older adults' QOL.

Exploring the causal pathway from gut microbiota to polycystic ovary syndrome: A network Mendelian randomization study.

Polycystic ovary syndrome (PCOS) is a complicated endocrine and metabolic syndrome with unclear pathogenesis. The gut microbiota sheds light on the etiology and pathophysiology of PCOS. We used Mendelian randomization (MR) studies to systematically evaluate the pathological mechanism gut microbiota causally associated with PCOS risk.

Synthesis of dithioacetals nucleophilic substitution and their antifungal activity evaluation.

A novel dual nucleophilic substitution reaction of dichloromethane with thiols has been developed, which affords dithioacetals in up to 96% yields. This dual substitution reaction with two different nucleophiles is also successfully developed with α-acyloxy sulfides as the product. In addition, antifungal activity tests against disclose that these α-acyloxy sulfides exhibit excellent antifungal activity with an inhibition rate up to 100 ± 0%.

Thrombospondin 2 is a tumor stemness protein marker based on the cluster analysis combined with immune infiltration in gastric cancer.

Platelet reactive protein 2 (PRP2) is closely related to the characteristics of tumor stem cells. Its role in cancer development and metastasis has received increasing attention, especially its interaction with the immune microenvironment. The study used cluster analysis to extract expression data of multiple cancer types from public databases, and combined with immune infiltration analysis, to evaluate the expression level of PRP2 and its correlation with different immune cell infiltration.

Expression feature and prognostic function of a novel immune checkpoint Siglec-15 in human colorectal cancer.

Background: Sialic acid-bound immunoglobulin lectin 15 (Siglec-15) plays an important role in the development of cancer. However, the association between Siglec-15 expression and clinicopathological characteristics of colorectal cancer (CRC) has not been fully investigated.

Methods: In this present study, a number of bioinformatics analyses were performed to provide an overview and detailed characteristics of Siglec-15.

Blood-based HYAL2 methylation as a potential marker for the preclinical detection of coronary heart disease and stroke.

Background: Coronary heart disease (CHD) and stroke have become the leading cause of premature mortality and morbidity worldwide. Therefore, sensitive and accurate biomarkers for early detection of CHD and stroke are urgently needed for effective prevention and treatment. We aim to investigate the association between blood-based HYAL2 methylation and the risk of CHD and stroke in Chinese population.

Smartphone addiction habit is positively associated with coronary artery disease and its severity in Chinese adults: a case-control study.

Background: Coronary artery disease (CAD) has a high incidence and poor prognosis worldwide. It has been confirmed that smartphone addiction (SA) habit can increase the incidence of hypertension and obesity in adolescents. However, the association of SA with CAD and its severity in Chinese adults remains largely unknown.

Characteristics of pulse wave velocity and its correlation with cardiovascular disease risk factors in healthy individuals.

Background: Cardiovascular disease (CVD) is a major cause of human mortality and has become the leading cause of death worldwide. Existing studies indicate that structural and functional damage to the main arteries represents a significant risk factor for early vascular lesions and many CVDs.

Aims: This study aimed to explore characteristics of carotid-femoral pulse wave velocity (cfPWV) and its correlation with cardiovascular disease risk factors in healthy individuals.

Macrophage-derived exosomal miR-155 regulating hepatocyte pyroptosis in MAFLD.

Background: Previous studies have shown that pyroptosis in hepatocyte is essential for the development of MAFLD. Growing evidence has shown that exosomal miRNAs-mediated communication between inflammatory cells and hepatocyte is an important link in MAFLD. In the present study, we aim to elucidate whether macrophage-derived exosomal miRNAs contribute to the hepatocyte pyroptosis in the pathophysiological process of MAFLD.

[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR‑1301‑3p/KIF23 axis.

Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR‑545‑3p (5'‑TGGCTCAGTTCAGCAGGAAC‑3') was actually for miR‑24‑3p (5'‑UGGCUCAGUUCAGCAGGAACAG‑3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR‑670‑5p also appeared to have potentially been written incorrectly.

Short-term exposure to ambient fine particulate matter constituents and myocardial infarction mortality.

Short-term ambient fine particulate matter (PM) exposure has been related to an increased risk of myocardial infarction (MI) death, but which PM constituents are associated with MI death and to what extent remain unclear. We aimed to explore the associations of short-term exposure to PM constituents with MI death and evaluate excess mortality. We conducted a time-stratified case-crossover study on 237,492 MI decedents in Jiangsu province, China during 2015-2021.

Identification of differentially expressed genes of blood leukocytes for Schizophrenia.

Background: Schizophrenia (SCZ) is a severe neurodevelopmental disorder with brain dysfunction. This study aimed to use bioinformatic analysis to identify candidate blood biomarkers for SCZ.

Methods: The study collected peripheral blood leukocyte samples of 9 SCZ patients and 20 healthy controls for RNA sequencing analysis.

Predictive nomogram model for severe coronary artery calcification in end-stage kidney disease patients.

Introduction: The Agatston coronary artery calcification score (CACS) is an assessment index for coronary artery calcification (CAC). This study aims to explore the characteristics of CAC in end-stage kidney disease (ESKD) patients and establish a predictive model to assess the risk of severe CAC in patients.

Methods: CACS of ESKD patients was assessed using an electrocardiogram-gated coronary computed tomography (CT) scan with the Agatston scoring method.

Inhibiting arachidonic acid generation mitigates aging-induced hyperinsulinemia and insulin resistance in mice.

Background: Aging-related type 2 diabetes (T2DM) is characterized by hyperinsulinemia, insulin resistance, and β-cell dysfunction. However, the underlying molecular mechanisms remain to be unclear.

Methods: We conducted non-targeted metabolomics to compare human serum samples from young adults (YA), elderly adults (EA), and elderly adults with diabetes (EA + DM) of Chinese population.

Factors associated with intrinsic capacity impairment in hospitalized older adults: a latent class analysis.

Background: Intrinsic capacity (IC) is proposed by the World Health Organization (WHO) to promote healthy aging. Although some studies have examined the factors influencing IC, few studies have comprehensively confirmed lifestyle factors on IC, especially IC impairment patterns. The present study aimed to identify the patterns of IC impairment and explore the lifestyle and other factors associated with different patterns of IC impairment.

A potential pathway for identifying hypertension among urban residents aged 60+ years in China: the role of health insurance.

Background: Identification is the first step for treatment of hypertension. However, the awareness rate of hypertension was not high globally. This study aimed to examine the potential role of health insurance for early-identifying hypertension among urban older residents in China.