Linifanib alone and in combination with metronomic chemotherapy is active on cutaneous T-cell lymphoma cells by targeting the AKT/mTOR signaling pathway.

Cutaneous T-cell lymphomas (CTCLs) are a rare and heterogeneous subset of skin-localized, non-Hodgkin lymphomas. Our aim was to evaluate the in vitro antitumor activity of the multi-kinase inhibitor linifanib, either alone or in combination with metronomic vinorelbine (mVNR) or etoposide (mETO), on CTCL cells. In vitro proliferation assay and Luminex analysis showed that long-term, daily exposure of linifanib significantly inhibited the proliferation of the human CTCL cell line HH, in a concentration-dependent manner (IC = 48.

Identification of red flags for IgG4-related disease: an international European Reference Network for Rare Connective Tissue Diseases framework.

IgG4-related disease is a rare fibroinflammatory condition. Prompt recognition is fundamental to initiate treatment and to prevent organ damage. Diagnostic and classification criteria are primarily intended for use by clinicians with established expertise in IgG4-related disease.

[The ETNA-AF Europe registry: 4-year data of edoxaban use in atrial fibrillation in the Italian real world compared to the European cohort].

Background: The prospective, single-arm, observational, phase 4 ETNA-AF Europe study collected real-world data about safety, effectiveness and therapeutic adherence in European patients with non-valvular atrial fibrillation newly prescribed with edoxaban and followed up for 4 years.

Methods: Overall, 13 164 patients were included in the full-analysis set, which means that they had at least one documentation after baseline at 4 years. The current paper reports about the 3329 Italian patients out of the whole European population.

BCL11A intellectual developmental disorder: defining the clinical spectrum and genotype-phenotype correlations.

An increasing number of individuals with intellectual developmental disorder (IDD) and heterozygous variants in BCL11A are identified, yet our knowledge of manifestations and mutational spectrum is lacking. To address this, we performed detailed analysis of 42 individuals with BCL11A-related IDD (BCL11A-IDD, a.k.

Follow-up of early breast cancer in a public health system: A 2024 AIGOM consensus project.

Breast cancer stands as the most frequently diagnosed cancer and the primary cause of cancer-related mortality among women worldwide, including Italy. With the increasing number of survivors, many are enrolled in regular follow-up programs. However, adherence to recommendations from scientific societies (such as ASCO, ESMO, AIOM) for breast cancer follow-up management varies in daily clinical practice across different cancer centers, potentially resulting in unequal management and escalating costs.

[Registers as central real world data source: the experience of the Italian Multiple Sclerosis and Related Disorders Register].

Registers collecting data from clinical practice (real world data) have gained increasing interest in recent years in the scientific, administrative, and regulatory fields. The value of longitudinal data collection in deepening knowledge about a specific pathology and its healthcare complexity is increasingly recognized. This article describes the development, organizational structure, and technical characteristics of the Italian Multiple Sclerosis and Related Disorders Register (RISM).

Classification of healthy and cancerous colon cells by Fourier transform infrared spectroscopy.

Colorectal cancer is one of the most diagnosed types of cancer in developed countries. Current diagnostic methods are partly dependent on pathologist experience and laboratories instrumentation. In this study, we used Fourier Transform Infrared (FTIR) spectroscopy in transflection mode, combined with Principal Components Analysis followed by Linear Discriminant Analysis (PCA-LDA) and Partial Least Squares - Discriminant Analysis (PLS-DA), to build a classification algorithm to diagnose colon cancer in cell samples, based on absorption spectra measured in two spectral ranges of the mid-infrared spectrum.

Phenotypic spectrum of myelin protein zero-related neuropathies: a large cohort study from five mutation clusters across Italy.

Background: We aimed to investigate the clinical features of a large cohort of patients with myelin protein zero ()-related neuropathy, focusing on the five main mutation clusters across Italy.

Methods: We retrospectively gathered a minimal data set of clinical information in a series of patients with these frequent mutations recruited among Italian Charcot-Marie-Tooth (CMT) registry centres, including disease onset/severity (CMTES-CMT Examination Score), motor/sensory symptoms and use of orthotics/aids.

Results: We collected data from 186 patients: 60 had the p.

Repaired Tetralogy of Fallot: Have We Understood the Right Timing of PVR?

Despite many advances in surgical repair during the past few decades, the majority of tetralogy of Fallot patients continue to experience residual hemodynamic and electrophysiological abnormalities. The actual issue, which has yet to be solved, is understanding how this disease evolves in each individual patient and, as a result, who is truly at risk of sudden death, as well as the proper timing of pulmonary valve replacement (PVR). Our responsibility should be to select the most appropriate time for each patient, going above and beyond imaging criteria used up to now to make such a clinically crucial decision.

Intermediate clinical endpoints in early-stage breast cancer: an analysis of individual patient data from the Gruppo Italiano Mammella and Mammella Intergruppo trials.

Background: Intermediate clinical endpoints (ICEs) are frequently used as primary endpoint in randomised trials (RCTs). We aim to assess whether changes in different ICEs can be used to predict changes in overall survival (OS) in adjuvant breast cancer trials.

Methods: Individual patient level data from adjuvant phase III RCTs conducted by the Gruppo Italiano Mammella (GIM) and Mammella Intergruppo (MIG) study groups were used.

Metronomic chemotherapy in hematology: Lessons from preclinical and clinical studies to build a solid rationale for future schedules.

Metronomic chemotherapy (mCHEMO), based on frequent, regular administration of low, but pharmacologically active drug doses, optimizes antitumor efficacy by targeting multiple targets and reducing toxicity of antineoplastic drugs. This minireview will summarize preclinical and clinical studies on cytotoxic drugs given at weekly, daily, or at continuous metronomic schedules alone or in combination with novel targeted agents for hematological malignancies, including lymphoma, multiple myeloma, and leukemia. Most of the preclinical in vitro and in vivo studies have reported a significant benefit of both mCHEMO monotherapy and combinatorial regimens compared with chemotherapy at the maximum tolerated dose.

Headspace Solid-Phase Microextraction/Gas Chromatography-Mass Spectrometry and Chemometric Approach for the Study of Volatile Profile in X-ray Irradiated Surface-Ripened Cheeses.

X-ray irradiation is an emerging non-thermal technology that is used as a preservation and sanitization technique to inactivate pathogens and spoilage organisms, increasing the shelf life of products. In this work, two different types of surface-ripened cheeses, Brie and Camembert, produced with cow milk, were treated with X-rays at three dose levels, 2.0, 4.

Interactions between achiral porphyrins and a mature miRNA.

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions.

Oocyte competence is comparable between progestin primed ovarian stimulation with Norethisterone acetate (NETA-PPOS) and GnRH-antagonist protocols: A matched case-control study in PGT-A cycles.

Objective: To outline oocyte competence after progestin primed ovarian stimulation with Norethisterone acetate (NETA-PPOS) compared to conventional GnRH-antagonist protocol.

Study Design: Retrospective matched case-control study involving advanced-maternal-age women undergoing ICSI with PGT-A. 89 NETA-PPOS were matched with 178 control patients based on maternal age and ovarian reserve biomarkers.

A long and winding road: My personal journey to oxytocin with no return.

The present paper is the personal narration of the author reviewing her scientific pathways that led her toward the study of oxytocin. My work began with a pioneering study showing a decreased number of the serotonin transporter proteins in romantic lovers. This unexpected finding promoted my interest in the neurobiology of human emotions and feelings, and significantly shifted my research focus from diseases to physiological states that underlie "love.

Melanocortin receptor 4 as a new target in melanoma therapy: Anticancer activity of the inhibitor ML00253764 alone and in association with B-raf inhibitor vemurafenib.

The aim of our study is to investigate in vitro and in vivo MC4R as a novel target in melanoma using the selective antagonist ML00253764 (ML) alone and in combination with vemurafenib, a B-rafV600E inhibitor. The human melanoma B-raf mutated A-2058 and WM 266-4 cell lines were used. An MC4R null A-2058 cell line was generated using a CRISPR/Cas9 system.

["Insomnia disorder": an overview of current models and of the complex link with psychopathology.].

Insomnia disorder is the most common sleep disorder. The new models frame insomnia as a stress-related disorder and a "24-hour" syndrome with night and day symptoms. The hyperarousal has been identified as the neurobiological mechanism underlying chronic insomnia.