Insulin stimulation of GLUT-4 translocation: a model for regulated recycling.

Insulin stimulates glucose transport in muscle and fat cells by causing the redistribution of a facilitative glucose transporter, GLUT-4, from an intracellular compartment to the cell surface. But what is this intracellular GLUT-4 compartment? It may be a specialized compartment, perhaps analogous to synaptic vesicles, or may simply be part of the endosomal system. Other constituents of this compartment might be regulators of GLUT-4 movement to the cell surface, and their identification should make it possible to find the link between the insulin signal transduction pathway and GLUT-4 translocation.

Transcription of individual genes in eukaryotic cells occurs randomly and infrequently.

Experimental evidence is presented indicating that the expression of a lacZ reporter gene driven by the HIV-1 long terminal repeat in a series of stably transfected, cloned macrophage cell lines occurs in a very small proportion of cells. The proportion of cells expressing lacZ, rather than the level of expression in each cell, is regulated by external stimuli such as LPS and phorbol ester. Based upon these and published data we propose that transcription in eukaryotic cells occurs in short pulses interspersed by long periods of inactivity of indeterminate duration.

Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors.

Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3').

Comparison of the expression and function of the transcription factor PU.1 (Spi-1 proto-oncogene) between murine macrophages and B lymphocytes.

The expression of mRNA encoding the DNA-binding protein PU.1 (Spi-1) is restricted to B lymphocytes and macrophages. The role of PU.

Identification of a marsupial OTF1 gene: cross-species STS analysis and in situ cross-hybridization to Macropus eugenii chromosomes 3/4 and 5.

The ability of the human octamer-binding transcription factor 1 (gene symbol: OTF1) sequence tagged site (STS) marker to identify cross-species gene homologues has been assessed using the marsupial Macropus eugenii genome. Two regions of sequence homology with human OTF1 have been located on M. eugenii chromosomes 3/4 and 5 by in situ hybridization.

Effects of the tat and nef gene products of human immunodeficiency virus type 1 (HIV-1) on transcription controlled by the HIV-1 long terminal repeat and on cell growth in macrophages.

The RAW264 murine macrophage cell line was used as a model to examine the role of the tat and nef gene products in the transcription regulation of the human immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR) in macrophages. Contrary to claims that the activity of the HIV-1 LTR responds poorly in rodent cells to trans activation by the viral tat gene product, cotransfection of RAW264 cells with a tat expression plasmid in transient transfection assays caused a > 20-fold increase in reporter gene expression that was inhibited by mutations in the TAR region. RAW264 cells stably transfected with the tat plasmid displayed similarly elevated HIV-1 LTR-driven reporter gene activity.

Identification of a thyroid hormone response element in the mouse myogenin gene: characterization of the thyroid hormone and retinoid X receptor heterodimeric binding site.

Thyroid hormones are positive regulators of muscle development in vivo. Triiodo-L-thyronine (T3) treatment of myogenic cell lines results in the precocious expression of myogenin, a muscle specific, helix-loop-helix factor that can trans-activate muscle specific gene expression (G. Carnac et al.

Common components in the assembly of type 4 fimbriae, DNA transfer systems, filamentous phage and protein-secretion apparatus: a general system for the formation of surface-associated protein complexes.

The Pseudomonas aeruginosa genes pilB-D and pilQ are necessary for the assembly of type 4 fimbriae. Homologues of these genes and of the subunit (pilin) gene have been described in various different bacterial species, but not always in association with type 4 fimbrial biosynthesis and function. Pil-like proteins are also involved in protein secretion, DNA transfer by conjugation and transformation, and morphogensis of filamentous bacteriophages.

Isolation and characterization of the genes encoding mouse and human type-5 acid phosphatase.

The gene (mT5AP) encoding murine type-5 acid phosphatase has been isolated and completely sequenced while the gene (hT5AP) encoding human T5AP has been partly sequenced. The murine gene spans 4 kb and contains five exons. Exon 1 is completely non-coding and exon 2 starts with the initiation codon in both mT5AP and hT5AP.

Characterization of pilQ, a new gene required for the biogenesis of type 4 fimbriae in Pseudomonas aeruginosa.

Type 4 fimbriae are produced by a variety of pathogens, in which they appear to function in adhesion to epithelial cells, and in a form of surface translocation called twitching motility. Using transposon mutagenesis of Pseudomonas aeruginosa, we have identified a new locus required for fimbrial assembly. This locus contains the gene pilQ which encodes a 77 kDa protein with an N-terminal hydrophobic signal sequence characteristic of secretory proteins.

Cystic fibrosis transmembrane conductance regulator splice variants are not conserved and fail to produce chloride channels.

In the human CFTR only the rare exon 4- splice variant is conserved in mice. We have discovered two novel murine variants, exon 5- and exon 11b+. The exon 5- variant represents up to 40% of mRNA in all CFTR-expressing tissues and leaves the reading frame intact.

The resistance of macrophage-like tumour cell lines to growth inhibition by lipopolysaccharide and pertussis toxin.

The process of tumorigenesis is frequently associated with resistance to growth inhibition by physiological regulators of normal cells. Murine macrophage-like cell lines BAC1.2F5, RAW264, J774.

Expression of mRNA encoding the macrophage colony-stimulating factor receptor (c-fms) is controlled by a constitutive promoter and tissue-specific transcription elongation.

The gene encoding the receptor for macrophage colony-stimulating factor 1 (CSF-1), the c-fms protooncogene, is selectively expressed in immature and mature mononuclear phagocytes and trophoblasts. Exon 1 is expressed only in trophoblasts. Isolation and sequencing of genomic DNA flanking exon 2 of the murine c-fms gene revealed a TATA-less promoter with significant homology to human c-fms.

Chromosomal structure and expression of the human OTF1 locus encoding the Oct-1 protein.

The genomic structure of the POU domain containing oct-1 gene (OTF1 locus) coding region has been determined using human DNA recombinant bacteriophage and a yeast artificial chromosome clone. The gene is encoded by 16 exons spanning over 150 kb, and the Oct-1 protein reading frame has been extended to 766 amino acids. The exonic structure has been compared to the mouse Oct-2 protein and reveals a conservation of exon-intron boundaries as well as protein sequence similarity.

Electroporation and DNA-dependent cell death in murine macrophages.

The difficulty of transfecting primary macrophages and macrophage cell lines has meant that relatively few studies on regulation of gene expression have been performed in these cells. This study has optimized an electroporation procedure for the macrophage cell line RAW 264, but shows that introduction of DNA into the cytoplasm of primary macrophages by electroporation is toxic to the cells. It is proposed that this cell death may have a physiological role in defence against certain viral infections which result in accumulation of cytoplasmic DNA.

Characterization of the thyroid hormone response element in the skeletal alpha-actin gene: negative regulation of T3 receptor binding by the retinoid X receptor.

We have identified a T3 response element (TRE) in the human skeletal alpha-actin gene between nucleotide positions -273 and -249 (5' GGGCAACTGGGTCGGGTCAGGAGGG 3') that is accommodated by the core receptor binding motif, A/G GG T/A C A/G. This sequence conferred appropriate hormonal regulation in a thyroid hormone receptor (TR alpha) dependent manner to an enhancerless SV40 promoter. Electrophoretic mobility shift assay experiments showed that Escherichia coli expressed and affinity purified TR alpha bound to the skeletal alpha-actin TRE in a sequence specific manner.

PilS and PilR, a two-component transcriptional regulatory system controlling expression of type 4 fimbriae in Pseudomonas aeruginosa.

Transposon mutagenesis was used to identify genes necessary for the expression of Pseudomonas aeruginosa type 4 fimbriae. In a library of 12,700 mutants, 147 were observed to have lost the spreading colony morphology associated with the presence of functional fimbriae. Of these, 28 had also acquired resistance to the fimbrial-specific bacteriophage PO4.

Analysis of gene expression by PCR.

Methods used to study gene expression rely on two basic conditions. First, sufficient tissue must be available for analysis, and second, the gene must be expressed at a level high enough to be detectable by the method used. Where the gene of interest is expressed in small tissues or groups of cells, for example, in mouse embryos, or where transcripts are present in vanishingly low amounts, it is often difficult to perform Northern blotting, RNase protection assays, or in situ hybridization.

The first disulphide loop of the rabbit growth hormone receptor is required for binding to the hormone.

Residues within the first disulphide loop of the GH receptor are highly conserved, and the two cysteines forming this motif are conserved across many cytokine receptors. We have used site-directed mutagenesis and the polymerase chain reaction with splicing by overlap extension to show that these residues are essential for binding of bovine (b)GH and human (h)GH to the rabbit GH receptor. When all residues within this loop were replaced with an equivalent polyalanine sequence, hormone binding was abolished.

Mammalian sex-determining genes.

The recent cloning of the Y-linked sex-determining gene SRY has ended one of the most notorious gene hunts in mammalian molecular genetics. Attention has now been turned to characterizing this gene further and studying how it acts as a switch in the choice of male or female developmental pathways.