Salivary biomarkers for discriminating periodontitis in the presence of diabetes.

Aim: Salivary biomarkers can help in assessment of periodontitis; however, concentrations may be altered in the presence of diabetes. Hence, the ability of salivary biomarkers to discriminate periodontally healthy type II diabetics (T2DM) from T2DM who have periodontitis was examined.

Methods: Ninety-two participants (29 with T2DM with chronic periodontitis, DWP; 32 T2DM without chronic periodontitis, DWoP; and 31 Not Periodontitis, NP) provided saliva and clinical parameters of periodontal health were recorded.

Oral commensal bacteria differentially modulate epithelial cell death.

Objective: Epithelial cell death is an important innate mechanism at mucosal surfaces, which enables the elimination of pathogens and modulates immunoinflammatory responses. Based on the antimicrobial and anti-inflammatory properties of cell death, we hypothesized that oral epithelial cell (OECs) death is differentially modulated by oral bacteria.

Material And Methods: We evaluated the effect of oral commensals Streptococcus gordonii (Sg), Streptococcus sanguinis (Ss), and Veillonella parvula (Vp), and pathogens Porphyromonas gingivalis (Pg), Tannerella forsythia (Tf), and Fusobacterium nucleatum (Fn) on OEC death.

Grade C molar-incisor pattern periodontitis subgingival microbial profile before and after treatment.

This study evaluated the influence of periodontal therapy on the microbiological profile of individuals with Grade C Molar-Incisor Pattern Periodontitis (C/MIP). Fifty-three African-American participants between the ages of 5-25, diagnosed with C/MIP were included. Patients underwent full mouth mechanical debridement with systemic antibiotics (metronidazole 250 mg + amoxicillin 500 mg, tid, 7 days).

Second Generation of Zafirlukast Derivatives with Improved Activity against the Oral Pathogen .

is a Gram-negative anaerobic pathogen that can trigger oral dysbiosis as an early event in the pathogenesis of periodontal disease. The FDA-approved drug zafirlukast (ZAF) was recently shown to display antibacterial activity against . Here, 15 novel ZAF derivatives were synthesized and evaluated for their antibacterial activity against and for their cytotoxic effects.

Dysregulation of genes and microRNAs in localized aggressive periodontitis.

Aim: Previous data from our laboratory have demonstrated that localized aggressive periodontitis (LAP) patients produce elevated levels of pro-inflammatory cytokines in response to TLR4 and TLR2 ligation compared to unrelated and periodontally healthy controls (HC). The aim of the present work is to evaluate the contribution of TLR-related gene expression and miRNA regulation in LAP disease.

Material And Methods: Peripheral blood mononuclear cells (PBMCs) from LAP and health control (HC) patients were isolated.

Maternal Oral Health Influences Infant Salivary Microbiome.

Oral microbiomes vary in cariogenic potential; these differences may be established early in life. A major concern is whether mothers transmit cariogenic bacteria to their children. Here we characterize early salivary microbiome development and the potential associations of that development with route of delivery, breastfeeding, and mother's oral health, and we evaluate transmission of microbes between mother and child.

Gingival tissue autophagy pathway gene expression profiles in periodontitis and aging.

Objective: We hypothesized that autophagy-related genes will be differentially expressed in periodontitis, suggesting an impaired gingival autophagic response associated with disease.

Background: Autophagy is a cellular physiologic mechanism to maintain tissue homeostasis, while deficient autophagic responses increase inflammation and susceptibility to infection.

Methods: Rhesus monkeys [<3 years to 23 years of age (n = 34)] were examined for periodontal health and naturally occurring periodontitis.

Co-occurrence of yeast, streptococci, dental decay, and gingivitis in the post-partum period: results of a longitudinal study.

: The interactions between yeast and streptococci species that lead to dental decay and gingivitis are poorly understood. Our study describes these associations among a cohort of 101 post-partum women enrolled in the Center for Oral Health Research in Appalachia, 2012-2013. : All eligible women without dental caries were included (n = 21) and the remainder were randomly sampled to represent the total number of decayed, missing, and filled teeth (DMFT) at enrollment.

Oral Microbiome and Gingival Transcriptome Profiles of Ligature-Induced Periodontitis.

This investigation evaluated the relationship of the oral microbiome and gingival transcriptome in health and periodontitis in nonhuman primates (). Subgingival plaque samples and gingival biopsies were collected from healthy sites and at sites undergoing ligature-induced periodontitis. Microbial samples were analyzed with 16S amplicon sequencing to identify bacterial profiles in young (3 to 7 y) and adult (12 to 23 y) animals.

Relationship between herpesviruses and periodontal disease progression.

Aim: To investigate the role of Epstein-Barr virus (EBV), cytomegalovirus (CMV), and anaerobic bacteria in the progression of periodontitis.

Methods: Eighty-one adults with generalized moderate to severe periodontitis were randomly assigned to: oral hygiene or scaling and root planning ± placebo or polyunsaturated fatty acids fish oil. Subgingival plaque samples collected from three healthy and three disease sites at weeks 0, 16, and 28 and from sites demonstrating disease progression were analysed for EBV, CMV, P.

Comparative Analysis of Gene Expression Patterns for Oral Epithelium-Related Functions with Aging.

Epithelial cells and functions of the epithelium are critical to the health of the oral cavity. We used a nonhuman primate model to profile the transcriptome of gingival tissues in health across the lifespan and hypothesized that in older animals, epithelial-related transcriptome patterns would reflect epithelial cells that are aggressively responsive to the surrounding environment and less able to modulate and resolve the noxious challenge from the bacteria. Rhesus monkeys (n = 34) with a healthy periodontium were distributed into four groups: ≤3 years (young), 3-7 years (adolescent), 12-16 years (adult), and 18-23 years (aged), and a buccal gingival sample from the premolar/molar region of each animal was obtained.

A Potential Role of Phospholipase 2 Group IIA (PLA-IIA) in P. gingivalis-Induced Oral Dysbiosis.

Porphyromonas gingivalis is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which P. gingivalis could abrogate the host-microbe symbiotic relationship leading to oral dysbiosis remain unclear.

Oral Mucosal Injury Caused by Targeted Cancer Therapies.

Targeted cancer therapies have fundamentally transformed the treatment of many types of cancers over the past decade, including breast, colorectal, lung, and pancreatic cancers, as well as lymphoma, leukemia, and multiple myeloma. The unique mechanisms of action of these agents have resulted in many patients experiencing enhanced tumor response together with a reduced adverse event profile as well. Toxicities do continue to occur, however, and in selected cases can be clinically challenging to manage.

Inhibition of osteoclastogenesis by opsonized .

A crucial step in the pathogenesis of periodontal disease (PD) is activation of osteoclasts (OC) by numerous virulence factors produced by (). To understand pathogenesis of periodontal disease and the role of specific adaptive immune responses, effects of antibodies on -induced OC differentiation and function were investigated. Human peripheral blood-derived monocytes were differentiated to osteoclasts in the presence or absence of: a) ; b) antibodies to ; and c) antibody-opsonized .

Transmission of dental fear from parent to adolescent in an Appalachian sample in the USA.

Background: Dental fear/anxiety is associated with numerous negative outcomes. State dental fear is known to be transmitted from parents to their children in the dental setting, but it is not known how trait fear/anxiety might be shared between parents and offspring long term, and especially for adolescents.

Aim: This study aimed to: (a) compare dental fear levels of adolescents and their parents; (b) predict adolescent dental fear based on demographic variables, fear of pain, and parental dental fear; and, (c) determine relative contributions of mothers' and fathers' dental fear to adolescent fear.

Biological response to peri-implantitis treatment.

Objective: To investigate biological markers of peri-implantitis (PIP) in crevicular fluid before and after surgical and antimicrobial therapy.

Material And Methods: Forty-eight participants (24 healthy implants and 24 PIP) were clinically evaluated, and peri-implant crevicular fluid (PICF) samples were collected at baseline for both groups, and at 3-months after surgical and antimicrobial treatment (ie, n = 21 PIP completers). Samples were analyzed for interleukin-1β (IL-1β), matrix metalloproteinase-8 (MMP-8), and macrophage inflammatory protein-1α (MIP-1α) using immunoassay and the results compared between groups.

Novel zafirlukast derivatives exhibit selective antibacterial activity against .

Periodontal disease is an oral chronic immune-inflammatory disease highly prevalent worldwide that is initiated by specific oral bacterial species leading to local and systemic effects. The development of new preventive/therapeutic strategies to specifically target oral periodontopathogens without perturbing oral microbiome species normally colonizing the oral cavity is needed. The fast and affordable strategy of repositioning of already FDA-approved drugs can be an answer to the development of novel treatments against periodontal pathogens such as .

The antibacterial effect of sonication and its potential medical application.

Introduction: Recent applications of ultrasonic probes include cataract removal and tennis elbow treatment. Early data support the use of ultrasonic probe debridement in the treatment of recalcitrant diabetic foot ulcers. No data are available concerning the potential antibacterial properties of the clinical grade, lower energy ultrasound probes.

Mother's Perceived Social Support and Children's Dental Caries in Northern Appalachia.

The purpose of this study was to examine whether perceived social support among mothers with high levels of dental caries was associated with their children experiencing high levels of dental caries. In West Virginia and Pennsylvania from 2002 to 2009, mothers were interviewed and clinical exams were conducted on their one- to six-year-old children. Two hundred and fifty mother-child dyads were analyzed where the mother had high dental caries.

Predictors of dental care utilization in north-central Appalachia in the USA.

Objectives: Dental utilization is an important determinant of oral health and well-being. The aim of this study was to evaluate potential associations between a variety of biopsychosocial factors and dental utilization in north-central Appalachia, USA, a region where oral health disparities are profound.

Methods: This study used household-based data from the Center for Oral Health Research in Appalachia (COHRA1) study in north-central Appalachia, including 449 families with 868 adults.

Microbiome Profiles of Ligature-Induced Periodontitis in Nonhuman Primates across the Life Span.

This investigation compared the microbiomes colonizing teeth during the initiation, progression, and resolution of periodontitis in nonhuman primates () at different ages. Subgingival plaque samples were collected at baseline; 0.5, 1, and 3 months following ligature-induced periodontitis; and following naturally occurring disease resolution at 5 months.

Effect of mouthwashes on the integrity of composite resin and resin modified glass ionomer: In vitro study.

Background: The constant search for an improved esthetic dental material has led investigators to realize that its performance depends on the conditions where the material is used. It has been probed that the contact with mouth rinses triggers alterations, reason why the aim of this study was to identify their possible effects of it on the integrity of nanohybrid composite resin and resin modified glass ionomer.

Material And Methods: A total of 144 samples were manufactured with two nanohybrid composite resins and two resin modified glass ionomer restorative materials.

Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA-IIA.

The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.

Biologic modelling of periodontal disease progression.

Aim: To investigate the synergistic role of biologic markers from saliva, serum and plaque in modelling periodontitis disease progression.

Material And Methods: This longitudinal study evaluated characteristics of disease progression in 114 patients with generalized moderate to severe periodontitis. The primary outcome was detection of sites with progressing attachment loss sites over 6 months in patients who received scaling and root planing or oral hygiene only.

Botulinum toxin in the management of myofascial pain associated with temporomandibular dysfunction.

Introduction: Critical evidence on the therapeutic efficacy of botulinum toxins (BTX) is still lacking for most pain conditions. The aim of this review was to evaluate the therapeutic efficacy of BTX in the management of temporomandibular myofascial pain.

Materials And Methods: Electronic databases PubMed, EMBASE, Scopus, Web of Science, and gray literature were searched for randomized clinical trials until February 2018 to answer a focused question "What is the effectiveness of botulinum toxin in the management of temporomandibular myofascial pain?" Two independent reviewers performed the study selection according to eligibility criteria.