Association of Specific Dietary Fatty Acids with Asthma in Urban School Children and Adolescents: Inferences from a Cross-Sectional Multicentric Study From India.

Objective: To assess the association of dietary fatty acids with asthma in Indian school children.

Methods: Children aged 6-16 years were enrolled from randomly selected urban schools in 10 cities. The International Study on Asthma and Allergies in Childhood Phase III Questionnaire was used to assess the prevalence of asthma.

Endophytic Microbial Community Structure and Dynamics Influence Agarwood Formation in Aquilaria malaccensis Lam.

Aquilaria malaccensis Lam., an Agarwood-producing tree native to Southeast Asia, secretes oleoresin, a resin with diverse applications, in response to injuries. To explore the role of endosphere microbial communities during Agarwood development, we utilized a metagenomics approach across three stages: non-symptomatic (NC), symptomatic early (IN), and symptomatic mature (IN1).

Identification, Biocontrol and Plant Growth Promotion Potential of Endophytic Streptomyces sp. a13.

Medicinal plants often harbour various endophytic actinomycetia, which are well known for their potent antimicrobial properties and plant growth-promoting traits. In this study, we isolated an endophytic actinomycetia, A13, from the leaves of tea clone P312 from the MEG Tea Estate, Meghalaya, India. The isolate A13 was identified as Streptomyces sp.

Hydrothermal conversion of biomass for co-production of carbon quantum dots and biofuels.

Agro-processing industries generate a substantial quantity of biomass wastes. Conversion of these wastes into valuable material could be profitable considering both environmental and economic aspects. Among various biomass conversion methods, hydrothermal conversion can be used for co-production of biofuel and other valuable materials like carbon quantum dots (CQDs) and activated carbons.

Learnings From an Audit of Anesthesia Information Management System for Neurosurgery Operating Room Utilization.

Background: An anesthesia information management system (AIMS) can be used to assess operating room utilization. The aim of this study was to assess neurosurgery OR utilization patterns using an AIMS.

Methods: This retrospective audit was performed at a tertiary neurosciences university hospital over a 1-year period.

Comparative analysis of biodesulfurization of dibenzothiophene (DBT) and 4,6-dimethyl dibenzothiophene (4,6-DMDBT) by 4S pathway using molecular simulations.

In this paper, we have analyzed biodesulfurization of dibenzothiophene (DBT) and 4,6-dibenzothiophene (4,6-DMDBT) by 4S metabolic pathway using molecular simulations. Docking analysis revealed lower binding energies and inhibition constants () for 4,6-DMDBT and its metabolic intermediates with DSZ enzymes than DBT and its intermediates. The complexes of substrate and its metabolites with DSZ enzymes had higher stability for 4,6-DMDBT than DBT owing to lower RMSF values than apoprotein.

The global impact of the COVID-19 pandemic on delays and disruptions in cancer care services: a systematic review and meta-analysis.

The coronavirus disease 2019 pandemic substantially impacted the delivery of cancer services and programs. Here we reviewed and synthesized the global scale and impact of pandemic-related delays and disruptions on cancer services, including diagnosis, diagnostic procedures, screening, treatment and supportive and palliative care. Based on data from 245 articles in 46 countries, we observed declines in the number of cancer screening participation (39.

Ethanolic extract of Akhuni induces ROS-mediated apoptosis through ERK and AKT signalling pathways: Insights from metabolic profiling and molecular docking studies.

Akhuni, an ethnic food of northeast India, induces ROS-mediated apoptosis in cancer cells. This is the first report on the anticancer potential of Akhuni. Akhuni is a traditional fermented soybean product known for its umami taste and delicacy, commonly used in Northeast India's cuisine.

A Prospective, Noninterventional Study to Evaluate the Impact of Emicizumab in the Management of Hemophilia A.

Background and objective Hemophilia A (HA) is a genetic bleeding disorder caused by a lack of factor VIII (FVIII) and is associated with frequent bleeding and joint damage. Traditional intravenous treatments for this condition are cumbersome and can lead to complications. Emicizumab, a bispecific monoclonal antibody, offers a promising subcutaneous alternative with potential safety and efficacy-related benefits.

Development and optimization of dapagliflozin oral nano-bilosomes using response surface method: evaluation, evaluation.

In treating type 2 diabetes, avoiding glucose reabsorption (glucotoxicity) and managing hyperglycemia are also important. A metabolic condition known as diabetes (type-2) is characterized by high blood sugar levels in comparison to normal Bilosomes (BLs) containing Dapagliflozin (Dapa) were formulated, optimized, and tested for oral therapeutic efficacy in the current investigation. Used the Box Behnken design to optimize the Dapa-BLs, formulated via a thin-film hydration technique.

Harnessing the potential of long non-coding RNAs in the pathophysiology of Alzheimer's disease.

Alzheimer's disease (AD), a diverse neurodegenerative disease, is the leading cause of dementia, accounting for 60-80 % of all cases. The pathophysiology of Alzheimer's disease is unknown, and there is no cure at this time. Recent developments in transcriptome-wide profiling have led to the identification of a number of non-coding RNAs (ncRNAs).

Development of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A.

The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.

Effect of Typha angustifolia, feeding modes and intermittent aeration on the performance of hybrid constructed wetland systems treating Reactive Black 5 diazo dye wastewater.

The current research assessed the effectiveness of four hybrid constructed wetland (HCW) systems for the remediation of synthetic dye wastewater with Reactive Black 5 (RB5) azo dye. All HCW systems had identical configurations, consisting of a horizontal CW followed by a vertical CW, and operated under diverse conditions such as the presence of plants (Typha angustifolia), feeding modes (batch and continuous) and intermittent aeration (4 h day). Anaerobic-aerobic conditions simulated within the HCW systems were crucial in removing the pollutants from synthetic dye wastewater.

Development of a novel and robust CuO-CoO@Biochar nanocomposite using Terminalia chebula leaf extract for reduction of nitro compounds and photodegradation of single and binary mixture of organic contaminants.

In this work, Terminalia chebula leaf extract was used to synthesize CuO-CoO nanoparticles, which were then embedded in a rice straw biochar. This new biochar-based nano-catalyst is used to photocatalytically degrade a variety of dyes (Eosin Y, Trypan Blue, Crystal Violet, Methylene Blue, Brilliant Green), as well as a binary mixture of Eosin Y and Trypan Blue dyes. It is also used for the catalytic reduction of nitro compounds (4-NP, 3-NP, and Picric acid).

Domestic sewage as a sustainable freshwater substitute for enhanced anaerobic digestion of lignocellulosic biomass.

Biochemical methane potential tests using water hyacinth (WH), pretreated water hyacinth (PWH), and Hydrilla verticillata (HV) as substrates using sewage media were explored. This study replaced the freshwater required to prepare the slurry for AD of organic solid waste with domestic sewage. Cow dung was used as the inoculum.

ICMR-MDRF Diabetes Biosamples: Cohort profile.

Background & objectives Biobanks are crucial for biomedical research, enabling new treatments and medical advancements. The biobank at the Madras Diabetes Research Foundation (MDRF) aims to gather, process, store, and distribute biospecimens to assist scientific studies. Methods This article details the profile of two cohorts: the Indian Council of Medical Research-India Diabetes (ICMR-INDIAB) study and the Registry of people with diabetes in India with young age at onset (ICMR-YDR).

Genetic variants and type 2 diabetes in India: a systematic review and meta-analysis of associated polymorphisms in case-control studies.

Background: India, with the largest population and second-highest type 2 diabetes mellitus (T2DM) prevalence, presents a unique genetic landscape. This study explores the genetic profiling of T2DM, aiming to bridge gaps in existing research and provide insights for further explorations.

Methods: We conducted a systematic review and meta-analysis of literature published up to September 2024 using databases like PubMed, Web of Science, Scopus, and Google Scholar to identify SNPs associated with T2DM in case-control studies within the Indian population.

Comparison of Clinical and Patient Reported Outcomes in One-Sided Cruciate-Retaining Versus Other-Sided Posterior Stabilizing Protheses in Bilateral Simultaneous Total Knee Arthroplasty.

Introduction: Cruciate retaining and posterior stabilizing knee systems are frequently used in total knee replacements. Most researchers compare the results of Cruciate Retaining (CR) and Posterior Stabilizing (PS) knees with those of a control group. The results of using both knee systems in a single patient in simultaneous Total Knee Arthroplasty (TKA) have been studied less.

The Molecular Detection and Therapeutic Management of Pathogenic Infection in a Goat: A Case Report.

A 2-year-old female Assam Hill goat was presented with a clinical history of anorexia, fever, mild anemia, rough body coat, dehydration, tachycardia, dyspnea and swelling of palpable lymph nodes. Hematology revealed low hemoglobin, packed cell volume, red blood cell and thrombocyte count. Biochemical analysis showed increased serum concentration of alanine aminotransferase (ALT), aspartate aminotransferase (AST), creatinine and urea in comparison to the normal reference range.

Application of the Sydney System for Classification and Reporting Lymph Node Cytopathology to Assess the Risk of Malignancy and its Diagnostic Accuracy.

Background: Fine-needle aspiration cytology (FNAC) of the lymph nodes is the first-line evaluation of lymphadenopathy of unknown etiology. For better diagnostic clarity and proper communication to clinicians, the Sydney System was proposed in 2020 for the performance, classification, and reporting of lymph node cytopathology. The present study was conducted to analyze the diagnostic performance and risk of malignancy (ROM) associated with each of the diagnostic categories of the proposed Sydney System.

Development of a novel multimedia tool for obtaining informed consent from survivors of sexual offenses and its comparison with the conventional method.

Background: Although multimedia tools for obtaining informed consent have been researched for surgeries, chemotherapy, and clinical trials, nothing has been explored in the context of the medico-legal examination of survivors of sexual offenses. The objective of the study was to develop a novel multimedia tool for obtaining informed consent and assent from survivors of sexual offenses and to compare it with conventional consent-taking procedure.

Methods: One cross-sectional study was conducted with survivors of sexual offenses as study participants.

A cross-sectional study of poisoning deaths by rubber latex processing acid in Tripura, India.

Background: Rubber latex processing acid poisoning is a frequently encountered phenomenon in Tripura. Formic acid is the preferred choice for coagulating rubber latex in rubber sheet manufacturing units. The objective of this study aimed to assess the epidemiological profile of poisoning deaths by rubber processing acid and to record their autopsy findings.

Wetlands function as carbon sink: Evaluation of few floodplains of middle Assam, northeast India in the perspective of climate change.

Floodplain wetlands are biologically rich and productive ecosystems that can capture carbon (C) from the atmosphere through macrophytes and phytoplanktons and hold it in soil for a long time thus playing a critical role in mitigating climate change. The Assam state of India has about 1392 floodplain wetlands engulfing around 100,000 ha area in the Brahmaputra and Barak River basin. In the present study, five different wetlands in the middle Assam viz.

Revolutionizing lung cancer treatment: Introducing PROTAC therapy as a novel paradigm in targeted therapeutics.

This comprehensive review explores the transformative potential of PROTAC (Proteolysis-Targeting Chimeras) therapy as a groundbreaking approach in the landscape of lung cancer treatment. The introduction provides a succinct overview of current challenges in lung cancer treatment, emphasizing the significance of targeted therapies. Focusing on PROTAC therapy, the article elucidates its mechanism of action, comparing it with traditional targeted therapies and highlighting the key components and design principles of PROTAC molecules.