Download full-text PDF |
Source |
|---|
Publication Analysis
Top Keywords
Similar Publications
Development of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A.
Mol Biotechnol
December 2024
Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.
The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.
View Article and Find Full Text PDFRotavirus rewires host cell metabolic pathways toward glutamine catabolism for effective virus infection.
Gut Microbes
November 2024
Division of Virology, ICMR-National Institute of Cholera and Enteric Diseases (presently ICMR-NIRBI), Kolkata, West Bengal, India.
Rotavirus (RV) accounts for 19.11% of global diarrheal deaths. Though GAVI assisted vaccine introduction has curtailed RV induced mortality, factors like RV strain diversity, differential infantile gut microbiome, malnutrition, interference from maternal antibodies and other administered vaccines, etc.
View Article and Find Full Text PDFPolymeric immunoglobulin receptor promotes Th2 immune response in the liver by increasing cholangiocytes derived IL-33: a diagnostic and therapeutic biomarker of biliary atresia.
EBioMedicine
October 2024
Department of Paediatric Surgery, Shengjing Hospital of China Medical University, Shenyang, Liaoning, 110004, PR China. Electronic address:
Background: Biliary atresia (BA) is a devastating neonatal cholangiopathy with an unclear pathogenesis, and prompt diagnosis of BA is currently challenging.
Methods: Proteomic and immunoassay analyses were performed with serum samples from 250 patients to find potential BA biomarkers. The expression features of polymeric immunoglobulin receptor (PIGR) were investigated using human biopsy samples, three different experimental mouse models, and cultured human biliary epithelial cells (BECs).
Reverse vaccinology-based multi-epitope vaccine design against Indian group A rotavirus targeting VP7, VP4, and VP6 proteins.
Microb Pathog
August 2024
Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Assam, 781039, India. Electronic address:
Rotavirus, a primary contributor to severe cases of infantile gastroenteritis on a global scale, results in significant morbidity and mortality in the under-five population, particularly in middle to low-income countries, including India. WHO-approved live-attenuated vaccines are linked to a heightened susceptibility to intussusception and exhibit low efficacy, primarily attributed to the high genetic diversity of rotavirus, varying over time and across different geographic regions. Herein, molecular data on Indian rotavirus A (RVA) has been reviewed through phylogenetic analysis, revealing G1P[8] to be the prevalent strain of RVA in India.
View Article and Find Full Text PDFPrevalence and factors associated with rotavirus diarrhea among children aged 3-24 months after the introduction of the vaccine at a referral hospital in Uganda: a cross-sectional study.
BMC Pediatr
May 2024
Department of Surgery, Kampala International University, Kampala, Uganda.
Article Synopsis
- Rotavirus continues to pose a risk for young children, with a study in Uganda showing a prevalence of 15.7% among those with acute watery diarrhea four years after the vaccine's introduction.
- Children under 12 months and those with male gender, or living in households with others suffering from diarrhea or with wells as a water source, were found to be at higher risk.
- The study indicates that rotavirus diarrhea cases have decreased significantly post-vaccination, but high levels of dehydration in affected children suggest ongoing public health concerns, especially regarding safe water access.
Want AI Summaries of new PubMed Abstracts delivered to your In-box?
Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!