Three 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAACAUGAAGAAUACCCAUG (III), corresponding to the minimal initiation region for the replicase gene of phage MS2 and fr or having some differences were synthesized using enzymatic methods. The template activity of the synthesized polynucleotides in initiation and their capacity to bind phage coat protein were studied under conditions optimal for native mRNA. Polynucleotides I and II exhibit template activity comparable to that of the native phage RNA fragments. Polynucleotide III with the destroyed SD sequence dit not manifest any functional activity either as template or in binding to MS2 phage coat protein.
Download full-text PDF |
Source |
|---|---|
| http://dx.doi.org/10.1016/0014-5793(85)80922-4 | DOI Listing |
Publication Analysis
Top Keywords
Similar Publications
Polymer Ligands with Multi-Nitrogen Heterocyclic Carbenes for Enhanced Stability and Reactivity in Nanoparticle Surface Functionalization.
Angew Chem Int Ed Engl
January 2025
Fudan University, Department of Macromolecular Science, 2205 Songhu Rd, 200438, Shanghai, CHINA.
Nitrogen heterocyclic carbenes (NHCs) are emerging as effective substitutes for conventional thiol ligands in surface functionalization of nanoparticles (NPs), offering exceptional stability to NPs under harsh conditions. However, the highly reactive feature of NHCs limits their use in introducing chemically active groups onto the NP surface. Herein, we develop a general yet robust strategy for the efficient surface functionalization of NPs with copolymer ligands bearing various functional groups.
View Article and Find Full Text PDFEdaravone is a Therapeutic Candidate for Doxorubicin-Induced Cardiomyopathy by Activating the Nrf2 Pathway.
Pharmacol Res Perspect
February 2025
Department of Pharmaceutical Health Care and Sciences, Tokyo University of Pharmacy and Life Sciences, Tokyo, Japan.
Doxorubicin (DOXO) has long been used clinically and remains a key drug in cancer therapy. DOXO-induced cardiomyopathy (DICM) is a chronic and fatal complication that severely limits the use of DOXO. However, there are very few therapeutic agents for DICM, and there is an urgent need to identify those that can be used for a larger number of patients.
View Article and Find Full Text PDFMaternal Western Diet Programmes Bile Acid Dysregulation and Hepatic Fibrosis in Fetal and Juvenile Macaques.
Liver Int
February 2025
Department of Pediatrics, University of Colorado Anschutz Medical Campus, Aurora, Colorado, USA.
Background And Aims: Maternal obesity increases the risk of the paediatric form of metabolic dysfunction-associated steatotic liver disease (MASLD), affecting up to 30% of youth, but the developmental origins remain poorly understood.
Methods: Using a Japanese macaque model, we investigated the impact of maternal Western-style diet (mWSD) or chow diet followed by postweaning WSD (pwWSD) or chow diet focusing on bile acid (BA) homeostasis and hepatic fibrosis in livers from third-trimester fetuses and 3-year-old juvenile offspring.
Results: Juveniles exposed to mWSD had increased hepatic collagen I/III content and stellate cell activation in portal regions.
Regulation of Rhizobial Nodulation Genes by Flavonoid-Independent NodD Supports Nitrogen-Fixing Symbioses With Legumes.
Environ Microbiol
January 2025
Department of Biology, University of Oxford, Oxford, UK.
Rhizobia and legumes form a symbiotic relationship resulting in the formation of root structures known as nodules, where bacteria fix nitrogen. Legumes release flavonoids that are detected by the rhizobial nodulation (Nod) protein NodD, initiating the transcriptional activation of nod genes and subsequent synthesis of Nod Factors (NFs). NFs then induce various legume responses essential for this symbiosis.
View Article and Find Full Text PDFDescriptive Epidemiology and Prognostic Significance of Diaphragm Thickness in the General Population: The Nagahama Study.
J Cachexia Sarcopenia Muscle
February 2025
Center for Genomic Medicine, Kyoto University Graduate School of Medicine, Kyoto, Japan.
Background: Diaphragm thickness is a potential marker of sarcopenia in addition to muscle mass and strength at extremities. We aimed to clarify the descriptive epidemiology and prognostic significance of diaphragm thickness in the general population.
Methods: The study participants were 3324 community residents (mean age: 61.
Want AI Summaries of new PubMed Abstracts delivered to your In-box?
Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!