Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions. UV-Vis titration revealed that meso-tetrakis(4--methylpyridyl) porphyrin (H2T4) and meso-tetrakis(4-carboxyphenylspermine) porphyrin (H2TCPPSpm4) formed complexes with distinct binding stoichiometries up to 6 : 1 and 3 : 1 ratios, respectively, and these results were supported by RLS and fluorescence, while the zinc(II) derivative porphyrin ZnT4 exhibited a weaker interaction. ZnTCPPSpm4 formed aggregates in PBS with higher organization in the presence of miRNA. CD titrations displayed an induced CD signal in the Soret region for every porphyrin investigated, indicating that they can be used as chiroptical probes for miR-26b-5p. Lastly, CD melting experiments revealed that at a 1 : 1 ratio, porphyrins did not significantly affect miRNA stability, except for H2TCPPSpm4. However, at a 3 : 1 ratio, all porphyrins, except ZnTCPPSpm4, exhibited a strong destabilizing effect on miRNA secondary structures. These findings shed light on the structural versatility of miR-26b-5p and highlight the potential of porphyrins as chiroptical probes and modulators of miRNA stability.
Download full-text PDF |
Source |
|---|---|
| http://dx.doi.org/10.1039/d3nr05504c | DOI Listing |
Publication Analysis
Top Keywords
Similar Publications
A Helically-Twisted Stereodynamic Probe for Chiroptical Sensing of Chiral Amines through Point-to-Helical Chirality Transmission.
Chem Asian J
January 2025
Department of Chemistry, Indian Institute of Science Education and Research Bhopal (IISER Bhopal) Bhauri, Bhopal Bypass Road, Bhopal, 462066, India.
Chiral amines and amino alcohols form an important category of molecules employed in the designing of new drugs and catalyst. Herein, we present a helically-twisted stereodynamic dialdehyde probe 1 for the determining of absolute configuration, and enantiomeric excess of chiral amine and amino alcohols. Probe 1 is based on the pyridine-2,6-dicarboxamide (PDC) core and undergoes rapid interconversion between the P- and M- conformers.
View Article and Find Full Text PDFSensitive Detection of Hg and l-Cysteine through Optical Asymmetry-Tuned Fluorescence Switch Off-On Behavior in N-Doped Chiral Carbon Dot.
ACS Appl Bio Mater
December 2024
Department of Chemistry, Indian Institute of Technology, Kharagpur, West Bengal 721302, India.
Blue-emissive nitrogen-doped chiral carbon dots (d-NCD230 and l-NCD230) exhibiting antipodal chiroptical activity, synthesized from the thermal pyrolysis of citric acid and d/l-aspartic acid in 1:2 molar ratios, have been explored as chirality-based fluorescent turn-off/on probes for the detection of Hg and l-cysteine (l-Cys). Circular dichroism (CD) spectroscopy revealed that the chiroptical activity originates from a synergy among intrinsic chirality, chiral precursors on the NCD surface, and hybridization of lower energy levels within the embedded chiral chromophore. Quantitative analysis of optical asymmetry using the Kuhn asymmetry factor () at the CD signal of 312 nm showed a higher value for d-NCD230 (1.
View Article and Find Full Text PDFUnderstanding the structure-chiroptical activity relationship in chiral perovskites is of great significance as it provides a pathway to control light-matter interactions. Although many reports have shown various chiral structures with distinctive chiroptical responses, a clear structure-property relationship is still missing, partially stemming from the poor understanding of the optical activity mechanism. For instance, it remains unclear if and how the chiroptical activity is related to exciton spin splitting.
View Article and Find Full Text PDFOrganic Circularly Polarized Room-Temperature Phosphorescence: Strategies, Applications and Challenges.
Angew Chem Int Ed Engl
January 2025
Frontiers Science Center for Flexible Electronics (FSCFE), Ningbo Institute of Northwestern Polytechnical University, Northwestern Polytechnical University, Xi'an, 710072, China.
Organic circularly polarized luminescence (CPL) plays crucial roles in chemistry and biology for the potential in chiral recognition, asymmetric catalysis, 3D displays, and biological probes. The long-lived luminescence, large Stokes shift, and unique chiroptical properties make organic circularly polarized room-temperature phosphorescence (CPP) a new research hotspot in recent years. Nevertheless, achieving high-performance organic CPP is still challenging due to the sensitivity and complexity of integrating triplet excitons and polarization within organic materials.
View Article and Find Full Text PDFChiroptical Sensing of Amines With Isatins.
Chirality
November 2024
Department of Chemistry, Georgetown University, Washington, DC, USA.
Isatins are extensively researched compounds with diverse applications, particularly as synthetic precursors in pharmaceutical developments. However, their use as optical probes for enantioselective sensing of chiral amines has not been explored to date. Herein, we present a novel chiroptical assay with an optimized isatin that generates strong, red-shifted circular dichroism (CD) signals at approximately 380 nm upon ketimine formation with chiral amines.
View Article and Find Full Text PDFWant AI Summaries of new PubMed Abstracts delivered to your In-box?
Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!