Cytosine base editors optimized for genome editing in potato protoplasts.

In this study, we generated and compared three cytidine base editors (CBEs) tailor-made for potato (), which conferred up to 43% C-to-T conversion of all alleles in the protoplast pool. Earlier, gene-edited potato plants were successfully generated by polyethylene glycol-mediated CRISPR/Cas9 transformation of protoplasts followed by explant regeneration. In one study, a 3-4-fold increase in editing efficiency was obtained by replacing the standard U6-1 promotor with endogenous potato U6 promotors driving the expression of the gRNA. Here, we used this optimized construct (Cas9/U6-1::gRNA1, target gRNA sequence GGTCCTTGGAGCAAAACTGG) for the generation of CBEs tailor-made for potato and tested for C-to-T base editing in the granule-bound starch synthase 1 gene in the cultivar Desiree. First, the Cas9 was converted into a (D10A) nickase (nCas9). Next, one of three cytosine deaminases from human hAPOBEC3A (A3A), rat (evo_rAPOBEC1) (rA1), or sea lamprey (evo_CDA1) (CDA1) was C-terminally fused to nCas9 and a uracil-DNA glycosylase inhibitor, with each module interspaced with flexible linkers. The CBEs were overall highly efficient, with A3A having the best overall base editing activity, with an average 34.5%, 34.5%, and 27% C-to-T conversion at C4, C5, and C12, respectively, whereas CDA1 showed an average base editing activity of 34.5%, 34%, and 14.25% C-to-T conversion at C4, C5, and C12, respectively. rA1 exhibited an average base editing activity of 18.75% and 19% at C4 and C5 and was the only base editor to show no C-to-T conversion at C12.