A circular RNA (circRNA) is a non-coding RNA (ncRNA) derived from reverse splicing from pre-mRNA and is characterized by the absence of a cap structure at the 5' end and a poly-adenylated tail at the 3' end. Owing to the development of RNA sequencing and bioinformatics approaches in recent years, the important clinical value of circRNAs has been increasingly revealed. Circ_0067934 is an RNA molecule of 170 nucleotides located on chromosome 3q26.2. Circ_0067934 is formed via the reverse splicing of exons 15 and 16 in PRKCI (protein kinase C Iota). Recent studies revealed the upregulation or downregulation of circ_0067934 in various tumors. The expression of circ_0067934 was found to be correlated with tumor size, TNM stage, and poor prognosis. Based on experiments with cancer cells, circ_0067934 promotes cancer cell proliferation, migratory activity, and invasion when overexpressed or downregulated. The potential mechanism involves the binding of circ_0067934 to microRNAs (miRNAs; miR-545, miR-1304, miR-1301-3p, miR-1182, miR-7, and miR-1324) to regulate the post-transcriptional expression of genes. Other mechanisms include inhibition of the Wnt/β-catenin and PI3K/AKT signaling pathways. Here, we summarized the biological functions and possible mechanisms of circ_0067934 in different tumors to enable further exploration of its translational applications in clinical diagnosis, therapy, and prognostic assessments.
Download full-text PDF |
Source |
---|---|
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC10587307 | PMC |
http://dx.doi.org/10.1007/s13577-023-00962-y | DOI Listing |
Mol Med Rep
October 2024
Department of Gastroenterology, The First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu 210029, P.R. China.
Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR‑545‑3p (5'‑TGGCTCAGTTCAGCAGGAAC‑3') was actually for miR‑24‑3p (5'‑UGGCUCAGUUCAGCAGGAACAG‑3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR‑670‑5p also appeared to have potentially been written incorrectly.
View Article and Find Full Text PDFFront Oncol
April 2024
Department of General Surgery, The Second Affiliated Hospital of Nanjing Medical University, Nanjing, China.
Circular RNAs (circRNAs) are a new type of endogenous non-coding RNA formed by a covalent closed loop. CircRNAs are characterized by specificity, universality, conservation, and stability. They are abundant in eukaryotic cells and have biological regulatory roles at various transcriptional and post-transcriptional levels.
View Article and Find Full Text PDFHum Cell
November 2023
The First Affiliated Hospital of Nanchang University, Nanchang, 330006, Jiangxi Province, China.
A circular RNA (circRNA) is a non-coding RNA (ncRNA) derived from reverse splicing from pre-mRNA and is characterized by the absence of a cap structure at the 5' end and a poly-adenylated tail at the 3' end. Owing to the development of RNA sequencing and bioinformatics approaches in recent years, the important clinical value of circRNAs has been increasingly revealed. Circ_0067934 is an RNA molecule of 170 nucleotides located on chromosome 3q26.
View Article and Find Full Text PDFPathol Res Pract
May 2023
Department of Biochemistry, Faculty of Medicine, Tehran University of Medical Sciences, Tehran, Iran. Electronic address:
Circular RNAs, as a type of non-coding RNAs, are identified in a various cell. Circular RNAs have stable structures, conserved sequence, and tissue and cell-specific level. High throughput technologies have proposed that circular RNAs act via various mechanisms like sponging microRNAs and proteins, regulating transcription factors, and scaffolding mediators.
View Article and Find Full Text PDFMol Med Rep
June 2022
Department of Gastroenterology, The First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu 210029, P.R. China.
In recent years, circular RNAs (circRNAs/circs) have attracted significant attention due to their potentially important functions in a variety of human cancer types. circ_0067934 is a newly identified circRNA, the role of which in gastric cancer (GC) has yet to be reported, to the best of our knowledge. In the present study, the expression levels of circ_0067934, microRNA (miR)‑1301‑3p and kinesin family member 23 (KIF23) in GC cells were detected via reverse transcription‑quantitative PCR.
View Article and Find Full Text PDFEnter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!