The purpose was to describe wet bulb globe temperature (WBGT) throughout a high school fall athletic season (August to November) after a state-wide mandate requiring schools to use a WBGT-guided activity modification table with categories (AMTC). A cross-sectional research design utilized 30 South Carolina high schools. The independent variables were region (upstate, midlands, and coastal), sport (football, tennis, cross-country), month, start times (7-10 am, 10 am-3 pm, 3-6 pm, and 6-9 pm), and event type (practice, competition). Dependent variables were event frequency, average WBGT, and AMTC. Practice WBGT was 78.7 ± 8.2 °F (range: 34.7 to 99.0 °F). A significant difference for WBGT across month (F, 904.7 = 385.07, P < 0.001) existed, with early September hotter than all other months (84.8 °F ± 3.8, P < 0.001). Every month had practices in each AMTC, until early November. Most events (64.6%, n = 1986) did not change AMTC; however, 9.1% (n = 281) changed to a hotter category. The 10 am-3 pm start time was significantly hotter than all other time frames (83.0 °F ± 7.2, P < 0.05). Tennis experienced hotter practices (79.9 °F ± 6.9) than football (78.4 °F ± 8.5; P < 0.001) and cross country (78.2 °F ± 8.8, P < 0.001). Schools in the Midlands experienced hotter practices (80.1 °F ± 7.8) than upstate (P < 0.001) and coastal schools (P = 0.005). Competition WBGT was significantly cooler than practices (72.3 ± 10.5 °F, t = 12.04, P < 0.001) and differed across sports (F, 20.78 = 18.39, P < .001). Both cross-country (P = 0.003) and tennis (P < 0.001) were hotter than football. Schools should continuously monitor WBGT throughout practices and until November to optimize AMTC use. Risk mitigation strategies are needed for sports other than football to decrease the risk of exertional heat illnesses.

Download full-text PDF

Source
http://dx.doi.org/10.1007/s00484-023-02449-9DOI Listing

Publication Analysis

Top Keywords

globe temperature
8
high school
8
south carolina
8
variations wet-bulb
4
wet-bulb globe
4
temperature high
4
school athletics
4
athletics south
4
carolina purpose
4
purpose describe
4

Similar Publications

Ubiquitous white light-emitting diodes (LEDs) possess optical properties that differ from those of natural light. This difference can impact visual perception and biological functions, thus potentially affecting eye health. Myopia, which leads to visual impairments and potentially irreversible vision loss or blindness, is the most prevalent refractive error worldwide.

View Article and Find Full Text PDF

Purpose: To assess the ability of the Dolphin air-pulse aesthesiometer to present multiple stimuli, which are separated temporally (in sequence) or spatially (simultaneously).

Methods: Two studies were performed to explore the cooling effects induced by double air-puff stimuli generated by a novel aesthesiometer composed of two micro-blower integrated units. The stimuli were delivered sequentially or simultaneously at the same or different spatial locations to an in vitro eye model monitored using thermography.

View Article and Find Full Text PDF

Development of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A.

Mol Biotechnol

December 2024

Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.

The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.

View Article and Find Full Text PDF

Stability enhancement of Amphotericin B using 3D printed biomimetic polymeric corneal patch to treat fungal infections.

Int J Pharm

December 2024

Translational Pharmaceutics Research Laboratory (TPRL), Department of Pharmacy, Birla Institute of Technology and Sciences (BITS), Pilani, Hyderabad Campus, Hyderabad, Telangana 500078, India. Electronic address:

Amphotericin B eye drops (reconstituted from lyophilized Amphotericin B formulation indicated for intravenous use) is used off-label for fungal keratitis. However, the reconstituted formulation is stable only for a week, even after refrigeration. Moreover, a high dosing frequency makes it an inconvenient treatment practice.

View Article and Find Full Text PDF

Explicit metrics for implicit emotions: investigating physiological and gaze indices of learner emotions.

Front Psychol

December 2024

Departent of Learning, Data-Analytics and Technology, Faculty of Behavioural, Management and Social Sciences, University of Twente, Enschede, Netherlands.

Learning experiences are intertwined with emotions, which in turn have a significant effect on learning outcomes. Therefore, digital learning environments can benefit from taking the emotional state of the learner into account. To do so, the first step is real-time emotion detection which is made possible by sensors that can continuously collect physiological and eye-tracking data.

View Article and Find Full Text PDF

Want AI Summaries of new PubMed Abstracts delivered to your In-box?

Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!