First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family , genus ) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants () were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.