Download full-text PDF |
Source |
|---|---|
| http://dx.doi.org/10.1097/INF.0000000000003717 | DOI Listing |
Publication Analysis
Top Keywords
Similar Publications
Development of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A.
Mol Biotechnol
December 2024
Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.
The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.
View Article and Find Full Text PDFSpatial targeting and integration across vaccination, vitamin A and deworming programs throughout India 2019-21.
Int J Epidemiol
October 2024
Francis I. Proctor Foundation, University of California, San Francisco, CA, USA.
Article Synopsis
- Large-scale public health programs in India, such as immunizations and deworming, currently operate independently, which limits their overall efficiency.
- An analysis of survey data from over 86,000 children revealed that vaccination coverage varied significantly, with some vaccines reaching as low as 42% and others up to 95%, highlighting areas needing attention.
- Implementing an integrated strategy that combines multiple health interventions could significantly improve vaccine coverage and efficiency, suggesting that targeting specific under-vaccinated districts could lead to better health outcomes for children in India.
Assessing the basis for regulatory crediting of virus LRVs for secondary biological wastewater treatment: A systematic review.
Water Res
November 2024
Southern Nevada Water Authority, P.O. Box 99954, Las Vegas, NV 89193, United States. Electronic address:
Regulatory frameworks for potable reuse often include stringent log reduction value (LRV) targets to ensure public health protection against exposure to viruses and protozoa. To achieve overall LRV targets and reduce associated capital and operational costs, it is important to maximize LRV credits awarded to each unit process in a potable reuse treatment train. This may include processes that are historically uncredited or undercredited, such as secondary biological wastewater treatment incorporating activated sludge and secondary clarification.
View Article and Find Full Text PDFTrends in epidemiological characteristics and etiologies of diarrheal disease in children under five: an ecological study based on Global Burden of Disease study 2021.
Sci One Health
November 2024
Guangzhou Women and Children's Medical Center, Guangzhou Medical University, Guangzhou 510623, Guangdong, China.
Article Synopsis
- - Diarrhea poses a significant health risk to children under five, and the study analyzes data to understand its global impact and identify effective prevention strategies.
- - An analysis of Global Burden of Disease data from 1990 to 2021 shows a notable decline in diarrhea incidence, prevalence, mortality, and disability-adjusted life years (DALYs) among young children, indicating progress.
- - Future projections (2022-2035) suggest continued reductions in diarrhea rates, with major causes of mortality identified as wasting, underweight, and lack of exclusive breastfeeding, and rotavirus being the main pathogen linked to severe outcomes.
Study of rotavirus genotypes G and P in one Egyptian center-cross-sectional study.
Ital J Pediatr
November 2024
Pediatrics Department, Faculty of Medicine, Mansoura University, Mansoura, Egypt.
Article Synopsis
- - The study investigated rotavirus genotypes in children under 5 years old with gastroenteritis at Mansoura University Children's Hospital in Egypt, correlating genotypes to demographics and clinical details.
- - G1 was identified as the most common G genotype (24.7%) and P9 as the most prevalent P genotype (24.7%), with significant mixed genotypes found, especially G1P4 (85.7%).
- - The results showed a higher prevalence of rotavirus in females (55.3%) and indicated significant correlations with summer season occurrences and patients from rural areas.
Want AI Summaries of new PubMed Abstracts delivered to your In-box?
Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!