The defect engineering of two-dimensional (2D) materials has become a pivotal strategy for tuning the electrical and optical properties of the material. However, the reliable application of these atomically thin materials in practical devices require careful control of structural defects to avoid premature failure. Herein, a systematic investigation is presented to delineate the complex interactions among structural defects, the role of thermal mismatch between WS monolayer and different substrates, and their consequent effect on the fracture behavior of the monolayer. Detailed microscopic and Raman/PL spectroscopic observations enabled a direct correlation between thermal mismatch stress and crack patterns originating from the corner of faceted voids in the WS monolayer. Aberration-corrected STEM-HAADF imaging reveals the tensile strain localization around the faceted void corners. Density functional theory (DFT) simulations on interfacial interaction between the substrate (Silicon and sapphire -AlO) and monolayer WS revealed a binding energy between WS and Si substrate is 20 times higher than that with a sapphire substrate. This increased interfacial interaction in WS and substrate-aided thermal mismatch stress arising due to difference in thermal expansion coefficient to a maximum extent leading to fracture in monolayer WS. Finite element simulations revealed the stress distribution near the void in the WS monolayer, where the maximum stress was concentrated at the void tip.
Download full-text PDF |
Source |
---|---|
http://dx.doi.org/10.1021/acsami.2c00901 | DOI Listing |
Mol Biotechnol
December 2024
Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.
The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.
View Article and Find Full Text PDFSmall
December 2024
CAS Key Laboratory of Nanosystem and Hierarchical Fabrication, National Center for Nanoscience and Technology, Beijing, 100190, P. R. China.
Ferroelectric field-effect transistors (FeFETs) commonly utilize traditional oxide ferroelectric materials for their strong remanent polarization. Yet, integrating them with the standard complementary metal oxide semiconductor (CMOS) process is challenging due to the need for lattice matching and the high-temperature rapid thermal annealing process, which are not always compatible with CMOS fabrication. However, the advent of the ferroelectric semiconductor α-InSe offers a compelling solution to these challenges.
View Article and Find Full Text PDFMicrosyst Nanoeng
December 2024
School of Integrated Circuits and Electronics, Beijing Institute of Technology, Beijing, China.
Microgrippers are essential for assembly and manipulation at the micro- and nano-scales, facilitating important applications in microelectronics, MEMS, and biomedical engineering. To guarantee the safe handling of delicate materials and micro-objects, a microgripper needs to be designed to operate with exceptional precision, rapid response, user-friendly operation, strong reliability, and low power consumption. In this study, we develop an electrothermal actuated microgripper with Al-SiO bimorphs as the primary structural element.
View Article and Find Full Text PDFNano Lett
December 2024
Zhejiang Provincial Engineering Research Center of Energy Optoelectronic Materials and Devices, Ningbo Institute of Materials Technology and Engineering, Chinese Academy of Sciences, Ningbo 315201, China.
Robust bipolar devices based on exclusively ultrawide bandgap (UWBG) semiconductors are highly desired for advanced power electronics. The heterojunction strategy has been a prevailing method for fabricating a bipolar device due to the lack of effective bipolar doping in the same UWBG material. Here, we demonstrate a unique heterojunction design integrating the p-type diamond and n-type ε-GaO that achieves remarkable breakdown voltages surpassing 3000 V.
View Article and Find Full Text PDFEvol Lett
December 2024
Department of Genetics, Evolution and Environment, University College London, London, United Kingdom.
Mitochondrial function depends on the effective interactions between proteins and RNA encoded by the mitochondrial and nuclear genomes. Evidence suggests that both genomes respond to thermal selection and promote adaptation. However, the contribution of their epistatic interactions to life history phenotypes in the wild remains elusive.
View Article and Find Full Text PDFEnter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!