Download full-text PDF |
Source |
|---|---|
| http://dx.doi.org/10.1016/j.canlet.2022.215631 | DOI Listing |
Publication Analysis
Top Keywords
Similar Publications
Corrigendum: Serum exosomal circular RNA expression profile and regulative role in proliferative diabetic retinopathy.
Front Genet
November 2024
Department of Ophthalmology, The First Affiliated Hospital of Nanjing Medical University, Nanjing, China.
[This corrects the article DOI: 10.3389/fgene.2021.
View Article and Find Full Text PDF[Corrigendum] Circular RNAs in osteosarcoma: An update of recent studies (Review).
Int J Oncol
November 2024
School of Basic Medicine, Gannan Medical University, Ganzhou, Jiangxi 341000, P.R. China.
Article Synopsis
- The authors contacted the Editorial Office to clarify that their published article contained several errors, including incorrect mentions of specific circRNAs and their roles.
- They highlighted specific lines that needed revisions, such as correcting errors regarding the regulation of the Wnt/β-catenin signaling pathway and the associated miRNAs involved.
- Additionally, updates were necessary for Figure 3 and its legend to remove inaccurate references and correct the placement of visual elements; the authors expressed gratitude for the chance to publish their corrections and apologized for any confusion caused.
[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR‑1301‑3p/KIF23 axis.
Mol Med Rep
October 2024
Department of Gastroenterology, The First Affiliated Hospital of Nanjing Medical University, Nanjing, Jiangsu 210029, P.R. China.
Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR‑545‑3p (5'‑TGGCTCAGTTCAGCAGGAAC‑3') was actually for miR‑24‑3p (5'‑UGGCUCAGUUCAGCAGGAACAG‑3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR‑670‑5p also appeared to have potentially been written incorrectly.
View Article and Find Full Text PDFCorrigendum: Review of novel functions and implications of circular RNAs in hepatocellular carcinoma.
Front Oncol
February 2024
Department of Combination of Traditional Chinese Medicine and Western Medicine, School of Medicine, Henan University of Chinese Medicine, Zhengzhou, China.
[This corrects the article DOI: 10.3389/fonc.2023.
View Article and Find Full Text PDFCorrigendum to "Towards circular and sustainable restoration of a deeply polluted river basin: The Odiel River catchment (SW Spain)" [Sci. Total Environ. 907 (2024) 168078].
Sci Total Environ
April 2024
Department of Earth Sciences & Research Center on Natural Resources, Health and the Environment (RENSMA), University of Huelva, Campus 'El Carmen', s/n, 21071 Huelva, Spain.
Want AI Summaries of new PubMed Abstracts delivered to your In-box?
Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!