Involvement of -Acting Elements in Molecular Regulation of JH-Mediated Vitellogenin Gene 2 of Female .

Vitellogenins (Vgs) are yolk protein precursors that are regulated by juvenile hormone (JH) and/or 20-hydroxyecdysone (20E) in insects. JH acts as the principal gonadotropin that stimulates vitellogenesis in hemimetabolous insects. In this study, we cloned and characterized the () promoter. Multiple sites for putative transcription factor binding were predicted for the 1,804 bp promoter region, such as the Broad-Complex, ecdysone response element (EcRE), GATA, Hairy, JH response element (JHRE), and Methoprene (Met)-binding motif, among others. Luciferase reporter assay has identified that construct -177 bp is enough to support JH III induction but not 20E suppression. This 38 bp region (from -177 to -139 bp) contains two conserved response element half-sites separated by 2 nucleotides spacer (DR2) and is designated as RE (GAGTCACGGAGTCGCCGCTG). Mutation assay and luciferase assay data using mutated constructs verified the crucial role of G residues in RE for binding the isolated fat body nuclear protein. In 9 cells, a luciferase reporter placed under the control of a minimal promoter containing RE was induced by JH III in a dose- and time-dependent manner. Nuclear proteins isolated from previtellogenic female fat body cells bound to RE, and this binding was outcompeted by a 50-fold excess of cold DR4 and JH binding protein response elements (Chorion factor-I/Ultraspiracle). Affinity pull-down experiment with nuclear extracts of previtellogenic female fat body, using 31-bp probe RE as bait, yielded a 71 kDa candidate nuclear protein that may mediate the regulatory action of the JH III.