Human Immunodeficiency Virus (HIV) infection continues to be a significant health burden in many countries around the world. Current HIV treatment through a combination of different antiretroviral drugs (cART) effectively suppresses viral replication, but drug resistance and crossresistance are significant challenges. This has prompted the search for novel targets and agents, such as nucleic acid aptamers. Nucleic acid aptamers are oligonucleotides that attach to the target sites with high affinity and specificity. This review provides a target-by-target account of research into anti-HIV aptamers and summarises the challenges and prospects of this therapeutic strategy, specifically in the unique context of HIV infection.
Download full-text PDF |
Source |
|---|---|
| http://dx.doi.org/10.2174/1570162X19666210908114825 | DOI Listing |
Publication Analysis
Top Keywords
Similar Publications
Development and characterization of high-affinity aptamers for HIV protease detection.
Heliyon
November 2024
HIV-1 Molecular Epidemiology Laboratory, Instituto Ramón y Cajal de Investigación Sanitaria (IRYCIS), Microbiology Department, Hospital Universitario Ramón y Cajal, CIBER en Epidemiología y Salud Pública (CIBERESP), Madrid, 28034, Spain.
Background: There are 39 million people infected by the human immunodeficiency virus (HIV) and 1.3 million new annually infections with more than 150 variants circulating. Early HIV detection is crucial for timely antiretroviral therapy and transmission prevention, but no technique can detect HIV before 10 days of infection.
View Article and Find Full Text PDFMultiplexed shRNA-miRs as a candidate for anti HIV-1 therapy: strategies, challenges, and future potential.
J Genet Eng Biotechnol
December 2022
Department of Biomedicine, Indonesia International Institute for Life-Sciences (i3L), Jakarta, Indonesia.
The spread of HIV is on the rise and has become a global issue, especially for underdeveloped and developing countries. This is due to the fact that HIV majorly occurs asymptomatically and is implausible for early diagnosis. Recent advances in research and science have enabled the investigation of a new potential treatment involving gene-based therapy, known as RNA interference (RNAi) that will direct gene silencing and further compensate for natural variants and viral mutants.
View Article and Find Full Text PDFBiophysical Characterization of Novel DNA Aptamers against K103N/Y181C Double Mutant HIV-1 Reverse Transcriptase.
Molecules
January 2022
Department of Biochemistry, Faculty of Science, Kasetsart University, Bangkok 10900, Thailand.
The human immunodeficiency virus type-1 Reverse Transcriptase (HIV-1 RT) plays a pivotal role in essential viral replication and is the main target for antiviral therapy. The anti-HIV-1 RT drugs address resistance-associated mutations. This research focused on isolating the potential specific DNA aptamers against K103N/Y181C double mutant HIV-1 RT.
View Article and Find Full Text PDFMolecular dynamics simulation study of gold nanosheet as drug delivery vehicles for anti-HIV-1 aptamers.
Comput Biol Chem
December 2021
Molecular Simulation Laboratory (MSL), Azarbaijan Shahid Madani University, Tabriz, Iran; Department of Chemistry, Faculty of Basic Sciences, Azarbaijan Shahid Madani University, Tabriz, Iran; Molecular Sciences and Engineering Research Group (MSERG), Iran.
The adsorption process of three aptamers with gold nanosheet (GNS) as a drug carrier has been investigated with the help of molecular dynamics simulations. The sequencing of the considered aptamers are as (CUUCAUUGUAACUUCUCAUAAUUUCCCGAGGCUUUUACUUUCGGGGUCCU) and (CCGGGUCGUCCCCUACGGGGACUAAAGACUGUGUCCAACCGCCCUCGCCU) for AP1 and AP2, respectively. AP3 is a muted version of AP1 in which nucleotide positions 4, 6, 18, 28 and 39 have C4A, U6G, A18G, G28A, and U39C mutations.
View Article and Find Full Text PDFAnti-HIV Aptamers: Challenges and Prospects.
Curr HIV Res
May 2022
Department of Virology, National Health Laboratory Service, University of KwaZulu-Natal, c/o Inkosi Albert Luthuli Central Hospital, 5th Floor Laboratory Building, 800 Bellair Road, Mayville, Durban 4091, South Africa.
Human Immunodeficiency Virus (HIV) infection continues to be a significant health burden in many countries around the world. Current HIV treatment through a combination of different antiretroviral drugs (cART) effectively suppresses viral replication, but drug resistance and crossresistance are significant challenges. This has prompted the search for novel targets and agents, such as nucleic acid aptamers.
View Article and Find Full Text PDFWant AI Summaries of new PubMed Abstracts delivered to your In-box?
Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!