Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N)GGGAGACAAGAATAAGCA). The K of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC8209218PMC
http://dx.doi.org/10.1038/s41598-021-91826-8DOI Listing

Publication Analysis

Top Keywords

crimean-congo hemorrhagic
8
hemorrhagic fever
8
specific sensitive
8
rapid diagnostic
8
cchf virus
8
aptamer-antibody elasa
8
cchf
5
aptamer based
4
diagnosis
4
based diagnosis
4

Similar Publications

Crimean-Congo hemorrhagic fever (CCHF) is indeed to be considered as one of the most significant vector-borne diseases globally. The virus responsible for CCHF can persist in various animals and lead to severe infections in humans. Ticks of the family are the acknowledged vectors of CCHF virus (CCHFV) transmission to humans.

View Article and Find Full Text PDF

Crimean-Congo hemorrhagic fever (CCHF) is an acute tick-borne disease with a case fatality rate of up to 40% in humans, posing a significant health threat. This study investigates the 2022-23 CCHF outbreaks in Iraq, the highest recorded to date, and analyzes potential factors at the human-animal-environmental interface. Data from the Iraqi government, the World Health Organization, and the World Bank were used to analyze CCHF trends and affecting factors.

View Article and Find Full Text PDF

Serological evidence of Crimean-Congo haemorrhagic fever in domestic animals from eight regions of Namibia.

Acta Trop

January 2025

Dept. of Animal Medicine, Production and Health, University of Padova, Legnaro, viale dell'Università 16, 35020, Italy. Electronic address:

Crimean-Congo haemorrhagic fever (CCHF) is a viral zoonotic disease endemic to regions of Africa, the Balkans, the Middle East, and Asia, with increasing reports of cases in southern Europe. Human transmission occurs primarily through the bite of infected ticks and by body fluids from infected human. Crimean-Congo haemorrhagic fever virus (CCHFV) affects a broad host range, including both domestic and wild vertebrates.

View Article and Find Full Text PDF

Background: Crimean-Congo hemorrhagic fever is a tick-borne zoonotic disease that may be severe and is present in many African countries. We aimed to understand the seroprevalence and risk for Crimean-Congo hemorrhagic fever virus in Tanzania by testing archived serum samples from patients enrolled in a prospective cohort study.

Methods: We prospectively enrolled febrile inpatients and outpatients from 2012 through 2014 at two referral hospitals in northern Tanzania.

View Article and Find Full Text PDF

Screening for Crimean-Congo Haemorrhagic Fever Virus antibodies in humans living in an endemic area of Spain.

Enferm Infecc Microbiol Clin (Engl Ed)

January 2025

Servicio de Medicina Interna, Unidad de Infecciosas, HUS, IBSAL, e-INTRO, CIETUS, Universidad de Salamanca, Salamanca, Spain. Electronic address:

Introduction: Crimean-Congo haemorrhagic fever (CCHF) is an emerging tick-borne viral disease. It has been described in Spain in both ticks and humans. Until July 2024 most cases have been described in the central-western part of the Iberian Peninsula.

View Article and Find Full Text PDF

Want AI Summaries of new PubMed Abstracts delivered to your In-box?

Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!