Background: The classical paradigm of scar-related reentrant ventricular tachycardia (VT) features a circuit with a double loop figure-of-eight (F8) activation pattern.

Objective: The purpose of this study was to interrogate VT circuits with F8 activation patterns by entrainment mapping to differentiate an active loop from a passive loop.

Methods: Sixty VT circuits with >90% of tachycardia cycle length delineated in high resolution were retrospectively analyzed in 55 patients (nonischemic 49%). A pseudo-F8 VT circuit was defined as a double loop activation pattern driven by a single loop mechanism with a passive loop that yields a long postpacing interval (postpacing interval - tachycardia cycle length ≥ 30 ms).

Results: Single loop activation patterns were observed in 33% (n = 20). Of 40 circuits with F8 patterns by activation mapping, 20 were studied with entrainment mapping, where a passive loop was identified by a long postpacing interval in 50%. In 6 circuits where entrainment mapping was performed from both outer loop regions, all demonstrated asymmetric responses to entrainment, confirming a single loop mechanism. Entrainment from both lateral margins of the common pathway (n = 7) demonstrated an asymmetric response in 29%. In all pseudo-F8 circuits (n = 10), the shorter loop functioned as the active loop and ablation targeting the active loop side of the isthmus resulted in VT termination with a single radiofrequency application.

Conclusion: In a selected cohort, single loop mechanisms are more prevalent than double loop reentry in reentrant human VT. Half of VT circuits with double loop activation patterns can be demonstrated to be sustained by a single active loop mechanism by entrainment mapping. Ablation targeting the shorter active loop resulted in rapid termination during radiofrequency application.

Download full-text PDF

Source
http://dx.doi.org/10.1016/j.hrthm.2021.05.002DOI Listing

Publication Analysis

Top Keywords

double loop
20
single loop
20
active loop
20
loop
18
activation patterns
16
entrainment mapping
16
loop activation
12
loop mechanism
12
postpacing interval
12
ventricular tachycardia
8

Similar Publications

Nanoparticle-mediated light-driven LAMP combined with test strips for sensitive and rapid visual detection of antibiotic resistance genes.

J Hazard Mater

December 2024

State Key Laboratory of Food Science and Resources, Jiangnan University, Wuxi 214122, China; International Joint Laboratory on Food Safety, Institute of Analytical Food Safety, School of Food Science and Technology, Jiangnan University, Wuxi, Jiangsu 214122, China. Electronic address:

Antibiotic resistance genes (ARGs) are markers of drug-resistant pathogens, monitoring them contributes to prevent resistance to drugs. The detection methods for ARGs including PCR and isothermal amplification are sensitive and selective. However, it may take several hours or cannot be used on spot.

View Article and Find Full Text PDF

The tomato leaf miner (TLM), Phthorimaea absoluta Meyrick, 1917 (Lepidoptera: Gelechiidae) is a destructive invasive insect that has expanded its global distribution. Rapid and accurate identification of invasive pests is essential to support subsequent management and devise control measures. To accurately diagnose P.

View Article and Find Full Text PDF

The HNH endonuclease domain of the giant virus MutS7 specifically binds to branched DNA structures with single-stranded regions.

DNA Repair (Amst)

December 2024

Agriculture and Marine Science Program, Graduate School of Integrated Arts and Science, Kochi University, Nankoku, Kochi 783-8502, Japan; Agricultural Science, Graduate School of Integrated Arts and Science, Kochi University, Nankoku, Kochi 783-8502, Japan. Electronic address:

Most giant viruses including Mimiviridae family build large viral factories within the host cytoplasms. These giant viruses are presumed to possess specific genes that enable the rapid and massive replication of their large double-stranded DNA genomes within viral factories. It has been revealed that a functionally uncharacterized protein, MutS7, is expressed during the operational phase of the viral factory.

View Article and Find Full Text PDF

Development of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A.

Mol Biotechnol

December 2024

Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.

The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.

View Article and Find Full Text PDF

Analysis of mechanisms of the rabies virus P protein-nucleocapsid interaction using engineered N-protein peptides and potential applications in antivirals design.

Antiviral Res

December 2024

Department of Biochemistry and Pharmacology, University of Melbourne, Parkville, VIC 3010, Australia; Bio21 Molecular Science and Biotechnology Institute, University of Melbourne, Parkville, VIC 3010, Australia. Electronic address:

The Phosphoprotein (P protein) of the rabies virus has multiple roles in virus replication. A critical function is to act as a cofactor in genome replication and mRNA production through binding via its N-terminal region to the L protein, the essential enzyme for mRNA and genome synthesis/processing, and via its C-terminal domain (P) to the N protein and viral RNA (N-RNA) ribonucleoprotein complex. The binding site of the P on the N protein is a disordered loop that is expected to be phosphorylated at Ser389.

View Article and Find Full Text PDF

Want AI Summaries of new PubMed Abstracts delivered to your In-box?

Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!