Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), is a retrovirus having genome size of around 30 kb. Its genome contains a highly conserved leader sequence at its 5' end, which is added to all subgenomic mRNAs at their 5' terminus by a discontinuous transcription mechanism and regulates their translation. Targeting the leader sequence by RNA interference can be an effective approach to inhibit the viral replication. In the present study an in-silico prediction of highly effective siRNAs was performed to target the leader sequence using the online software siDirect version 2.0. Low seed-duplex stability, exact complementarity with target, at least three mismatches with any off-target and least number of off-targets, were considered as effective criteria for highly specific siRNA. Further validation of siRNA affinity for the target was accomplished by molecular docking by HNADOCK online server. Our results revealed four potential siRNAs, of which siRNA having guide strand sequence 5'GUUUAGAGAACAGAUCUACAA3' met almost all specificity criteria with no off-targets for guide strand. Molecular docking of all predicted siRNAs (guide strand) with the target leader sequence depicted highest binding score of -327.45 for above-mentioned siRNA. Furthermore, molecular docking of the passenger strand of the best candidate with off-target sequences gave significantly low binding scores. Hence, 5'GUUUAGAGAACAGAUCUACAA3' siRNA possess great potential to silence the leader sequence of SARS-CoV-2 with least off-target effect. Present study provides great scope for development of gene therapy against the prevailing COVID-19 disease, thus further research in this concern is urgently demanded.
Download full-text PDF |
Source |
|---|---|
| http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7995175 | PMC |
| http://dx.doi.org/10.1002/acg2.107 | DOI Listing |
Publication Analysis
Top Keywords
Similar Publications
Roles of Mature Domain Targeting Signals (MTSs) for Protein Translocation and Secretion in .
Int J Mol Sci
December 2024
Institute of Food Technology, Department of Food Science and Technology, BOKU University, 1190 Vienna, Austria.
is a potential bacterial cell factory to develop delivery systems for vaccines and therapeutic proteins. Much progress has been made in applications using engineered against, e.g.
View Article and Find Full Text PDFStructural basis of nearest-neighbor cooperativity in the ring-shaped gene regulatory protein TRAP from protein engineering and cryo-EM.
Proc Natl Acad Sci U S A
January 2025
Department of Chemistry and Biochemistry, The Ohio State University, Columbus, OH 43210.
The homo-dodecameric ring-shaped RNA binding attenuation protein (TRAP) from binds up to twelve tryptophan ligands (Trp) and becomes activated to bind a specific sequence in the 5' leader region of the operon mRNA, thereby downregulating biosynthesis of Trp. Thermodynamic measurements of Trp binding have revealed a range of cooperative behavior for different TRAP variants, even if the averaged apparent affinities for Trp have been found to be similar. Proximity between the ligand binding sites, and the ligand-coupled disorder-to-order transition has implicated nearest-neighbor interactions in cooperativity.
View Article and Find Full Text PDFDiscovery of Diverse CRISPR Leader Motifs, Putative Functions, and Applications for Enhanced CRISPR Detection and Subtype Annotation.
CRISPR J
January 2025
Department of Microbiology and Cell Biology, Montana State University, Bozeman, Montana, USA.
Bacteria and archaea acquire resistance to genetic parasites by preferentially integrating short fragments of foreign DNA at one end of a Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR). "Leader" DNA upstream of CRISPR loci regulates transcription and foreign DNA integration into the CRISPR. Here, we analyze 37,477 CRISPRs from 39,277 bacterial and 556 archaeal genomes to identify conserved sequence motifs in CRISPR leaders.
View Article and Find Full Text PDFDPV pUL15 possesses a potential NLS, which is important for the location of the terminase complex and for viral proliferation and genome cleavage.
Vet Res
January 2025
Engineering Research Center of Southwest Animal Disease Prevention and Control Technology, Ministry of Education, Chengdu, 611130, China.
In herpesvirus, the terminase subunit pUL15 is involved in cleavage of the viral genome concatemers in the nucleus. Previous studies have shown that herpes simplex virus 1 (HSV-1) pUL15 can enter the nucleus without other viral proteins and help other terminase subunits enter the nucleus. However, this study revealed that duck plague virus (DPV) pUL15 cannot localize independently to the nucleus and can only be localized in the nucleus in the presence of pUL28 and pUL33.
View Article and Find Full Text PDFEndosomal Escape and Nuclear Localization: Critical Barriers for Therapeutic Nucleic Acids.
Molecules
December 2024
Department of Medical Genetics, Faculty of Medicine and Dentistry, University of Alberta, Edmonton, AB T6G 2H7, Canada.
Therapeutic nucleic acids (TNAs) including antisense oligonucleotides (ASOs) and small interfering RNA (siRNA) have emerged as promising treatment strategies for a wide variety of diseases, offering the potential to modulate gene expression with a high degree of specificity. These small, synthetic nucleic acid-like molecules provide unique advantages over traditional pharmacological agents, including the ability to target previously "undruggable" genes. Despite this promise, several biological barriers severely limit their clinical efficacy.
View Article and Find Full Text PDFWant AI Summaries of new PubMed Abstracts delivered to your In-box?
Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!