With the completion of the human genome-sequencing project, there has been a resulting change in the focus of studies from genomics to proteomics. By utilizing the inherent advantages of molecular beacon probes and biofunctionalized nanoparticles, a series of novel principles, methods and techniques have been exploited for bioanalytical and biomedical studies. This review mainly discusses the applications of molecular beacon probes and biofunctionalized nanoparticles-based technologies for real-time, , highly sensitive and highly selective protein analysis, including the nonspecific or specific protein detection and separation, protein/DNA interaction studies, cell surface protein recognition, and antigen-antibody binding process-based bacteria assays. The introduction of molecular beacon probes and biofunctionalized nanoparticles into the protein analysis area would necessarily advance the proteomics research.
Download full-text PDF |
Source |
|---|---|
| http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7088759 | PMC |
| http://dx.doi.org/10.1007/s11426-010-0110-3 | DOI Listing |
Publication Analysis
Top Keywords
Similar Publications
Dual-signal fluorescence detection of miRNA based on nano-gold molecular beacon and in-situ generated silver nanoclusters coupled with multiple amplification.
Talanta
December 2024
College of Chemistry and Molecular Engineering. Qingdao University of Science and Technology, Qingdao, 266042, China. Electronic address:
In this work, a new dual-signal fluorescence strategy based on nano-gold molecular beacon (MB) and in-situ generated silver nano-clusters (NCs) coupled with multiple amplification technique was developed for sensitive detection of miRNA (let-7b). miRNA can recognize both hairpin probe (HP) and auxiliary DNA, inducing dual-cycle amplification-process to release plenty of DNA S2. As the report probe carboxyfluorescein (FAM) was modified on Au nanoparticles (AuNPs), the fluorescent signal was quenched due to the fluorescence resonance energy transfer (FRET).
View Article and Find Full Text PDFTargeted LNPs deliver IL-15 superagonists mRNA for precision cancer therapy.
Biomaterials
December 2024
Department of Biomedical Engineering, College of Future Technology, Peking University, Beijing, 100871, China; Beijing Advanced Center of RNA Biology (BEACON), Peking University, Beijing, 100871, China. Electronic address:
Interleukin-15 (IL-15) emerges as a promising immunotherapeutic candidate, but the therapeutic utility remains concern due to the unexpected systematic stress. Here, we propose that the mRNA lipid nanoparticle (mRNA-LNP) system can balance the issue through targeted delivery to increase IL-15 concentration in the tumor area and reduce leakage into the circulation. In the established Structure-driven TARgeting (STAR) platform, the LNP and LNP can effectively and selectively deliver optimized IL-15 superagonists mRNAs to local and lungs, respectively, in relevant tumor models.
View Article and Find Full Text PDFDevelopment of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A.
Mol Biotechnol
December 2024
Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.
The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.
View Article and Find Full Text PDFFinding potential inhibitors from phytochemicals against nucleoprotein of crimean congo fever virus using in silico approach.
Sci Rep
December 2024
Department of Chemical and Biological Engineering, Gachon University, Seongnam, 13120, Republic of Korea.
The Crimean Congo virus has been reported to be a part of the spherical RNA-enveloped viruses from the Bunyaviridae family. Crimean Congo fever (CCHF) is a fatal disease with having fatality rate of up to 40%. It is declared endemic by the World Health Organization.
View Article and Find Full Text PDFDetection of miR-133a-5p Using a Molecular Beacon Probe for Investigating Postmortem Intervals.
Noncoding RNA
November 2024
Department of Forensic Science, Graduate School, Catholic University of Pusan, Busan 46252, Republic of Korea.
When a body is discovered at a crime or murder scene, it is crucial to examine the body and estimate its postmortem interval (PMI). Accurate estimation of PMI is vital for identifying suspects and providing clues to resolve the case. MicroRNAs (miRNAs or miRs) are small non-coding RNAs that remain relatively stable in the cell nucleus even after death-related changes occur.
View Article and Find Full Text PDFWant AI Summaries of new PubMed Abstracts delivered to your In-box?
Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!