Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.
Download full-text PDF |
Source |
|---|---|
| http://www.ncbi.nlm.nih.gov/pmc/articles/PMC7026657 | PMC |
| http://dx.doi.org/10.1093/nar/gkz1207 | DOI Listing |
Publication Analysis
Top Keywords
Similar Publications
The Composition of Triterpene Glycosides in the Sea Cucumber : Anticancer Activity of the Glycosides against Three Human Breast Cancer Cell Lines and Quantitative Structure-Activity Relationships (QSAR).
Mar Drugs
June 2024
G.B. Elyakov Pacific Institute of Bioorganic Chemistry, Far Eastern Branch of the Russian Academy of Sciences, Pr. 100-letya Vladivostoka 159, 690022 Vladivostok, Russia.
Eight sulfated triterpene glycosides, peronioside A () and psolusosides A (), B (), G (), I (), L (), N () and P (), were isolated from the sea cucumber . Peronioside A () is a new glycoside, while compounds - were found previously in , indicating the phylogenetic and systematic closeness of these species of sea cucumbers. The activity of - against human erythrocytes and their cytotoxicity against the breast cancer cell lines MCF-7, T-47D and triple-negative MDA-MB-231 were tested.
View Article and Find Full Text PDFDecoding regulatory associations of G-quadruplex with epigenetic and transcriptomic functional components.
Front Genet
August 2022
Department of BioHealth Informatics, Indiana University School of Informatics and Computing, Indiana University-Purdue University Indianapolis, Indianapolis, IN, United States.
G-quadruplex (G4) has been previously observed to be associated with gene expression. In this study, we performed integrative analysis on G4 multi-omics data from in-silicon prediction and ChIP-seq in human genome. Potential G4 sites were classified into three distinguished groups, such as one group of high-confidence G4-forming locations (G4-II) and groups only containing either ChIP-seq detected G4s (G4-I) or predicted G4 motif candidates (G4-III).
View Article and Find Full Text PDFMolecular cloning and expression analysis of CD79a and CD79b in rainbow trout (Oncorhynchus mykiss) after bacterial, parasitic, and viral infection.
Fish Shellfish Immunol
November 2021
State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei, 430072, China. Electronic address:
CD79a and CD79b heterodimers are important components that consist of B cell receptor compound, which play a crucial role in transduction activation signal of the antigen binding BCR, and B cell development and antibody production. In order to investigate the characters and potential functions of CD79a and CD79b in rainbow trout (Oncorhynchus mykiss), we firstly cloned and analyzed the expression of CD79a and CD79b and found that the cDNA sequences of CD79a and CD79b both contained open reading frame of 711 and 645 bp in length for encoding the protein of 237 and 215 amino acid residues, respectively. The predicted amino acid sequences from trout were highly conserved with those of other teleost fishes in structure.
View Article and Find Full Text PDFCytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.
Nucleic Acids Res
February 2020
Institute of Atomic and Molecular Sciences, Academia Sinica, Taipei 106, Taiwan, R.O.C.
Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure.
View Article and Find Full Text PDFSolution structure of actinomycin-DNA complexes: drug intercalation at isolated G-C sites.
J Biomol NMR
November 1991
Department of Biochemistry and Molecular Biophysics, College of Physicians and Surgeons, Columbia University, New York, NY 10032.
The actinomycin-D-d(A1-A2-A3-G4-C5-T6-T7-T8) complex (1 drug per duplex) has been generated in aqueous solution and its structure characterized by a combined application of two-dimensional NMR experiments and molecular dynamics calculations. We have assigned the exchangeable and nonexchangeable proton resonances of Act and d(A3GCT3) in the complex and identified the intermolecular proton-proton NOEs that define the alignment of the antitumor agent at its binding site on duplex DNA. The molecular dynamics calculations were guided by 70 intermolecular distance constraints between Act and nucleic acid protons in the complex.
View Article and Find Full Text PDFWant AI Summaries of new PubMed Abstracts delivered to your In-box?
Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!