First Report of Capsicum annuum Plants Infected by Tomato Yellow Leaf Curl Virus.

Plant Dis

IM Cuadrado CIFH "La Mojonera" El Ejido, Almería, Spain.

Published: December 1999

Infection of tomato crops by tomato yellow leaf curl virus (TYLCV) has occurred annually in southern Spain since 1992. In 1997, TYLCV also was reported in common bean (Phaseolus vulgaris) (2) in southern Spain. During the summer of 1999, we observed pepper plants (Capsicum annuum) from a greenhouse in Almería (Spain) exhibiting clear leaf internervial and marginal chlorosis and upward curling of the leaflet margin. Total nucleic acids were extracted from five plants with symptoms and analyzed by Southern blot hybridization and polymerase chain reaction (PCR). As a probe, we used a plasmid (pSP72/97) encompassing the complete genome of the Spanish isolate of TYLCV-IS (1). A positive signal was obtained from three samples. A pair of primers (OTYA3/OTYA6) designed to amplify TYLCV was used for detection in samples (OTYA3: GGGTCGACGTCATCAATGACG; OTYA6: CTACATGAGAATGGGGAACC). Using PCR, we were able to obtain fragments of the expected sizes (649 bp for OTYA3/OTYA6) from four of five samples analyzed. Amplified fragments were later analyzed by restriction fragment length polymorphism with three cutter enzymes (AluI, RsaI, and HinfI). The restriction pattern obtained in all cases corresponded with the Spanish isolate of TYLCV-IS. One of the fragments amplified with OTYA3/OTYA6 was fully sequenced. The sequence was 100% identical to that previously reported for the Spanish isolate of TYLCV-IS. This is the first report of TYLCV infection in C. annuum, which is one of the most important commercial crops in southeastern Spain. Work is in progress to determine whether the presence of TYLCV-IS in pepper plants is responsible for the symptoms described here. References: (1) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997. (2) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.

Download full-text PDF

Source
http://dx.doi.org/10.1094/PDIS.1999.83.12.1176DDOI Listing

Publication Analysis

Top Keywords

spanish isolate
12
isolate tylcv-is
12
capsicum annuum
8
tomato yellow
8
yellow leaf
8
leaf curl
8
curl virus
8
southern spain
8
pepper plants
8
navas-castillo plant
8

Similar Publications

Second-language speakers are more likely to strategically reuse the words of their conversation partners (Zhang & Nicol, 2022). This study investigates if this is also the case for lower-proficiency bilinguals from a bilingual community, who use language more implicitly, and if there is more alignment with lower than with higher proficiency, provided the words to be aligned to are all highly familiar. In two experiments, Spanish-English bilinguals took turns with a confederate to name and match pictures in Spanish.

View Article and Find Full Text PDF

The phyllosphere microbiome can positively or negatively impact plant health and growth, but we currently lack the tools to control microbiome composition. Contributing to a growing collection of bacteriophages (phages) targeting bacteria living in the wheat phyllosphere, we here isolate and sequence eight novel phages targeting common phyllosphere Erwinia and Pseudomonas strains, including two jumbo phages. We characterize genomic, phylogenetic, and morphological traits from these phages and argue for establishing four novel viral genera.

View Article and Find Full Text PDF

Mechanisms of recalcitrant fucoidan breakdown in marine Planctomycetota.

Nat Commun

December 2024

AZTI, Marine Research, Basque Research and Technology Alliance (BRTA), Sukarrieta, Spain.

Marine brown algae produce the highly recalcitrant polysaccharide fucoidan, contributing to long-term oceanic carbon storage and climate regulation. Fucoidan is degraded by specialized heterotrophic bacteria, which promote ecosystem function and global carbon turnover using largely uncharacterized mechanisms. Here, we isolate and study two Planctomycetota strains from the microbiome associated with the alga Fucus spiralis, which grow efficiently on chemically diverse fucoidans.

View Article and Find Full Text PDF

Moving beyond word frequency based on tally counting: AI-generated familiarity estimates of words and phrases are an interesting additional index of language knowledge.

Behav Res Methods

December 2024

ETSI de Telecomunicación, Universidad Politécnica de Madrid, Avenida Complutense, 30, 28040, Madrid, Spain.

This study investigates the potential of large language models (LLMs) to estimate the familiarity of words and multi-word expressions (MWEs). We validated LLM estimates for isolated words using existing human familiarity ratings and found strong correlations. LLM familiarity estimates performed even better in predicting lexical decision and naming performance in megastudies than the best available word frequency measures.

View Article and Find Full Text PDF

[Identification and antibiotic susceptibility of Aeromonas spp. in a University Hospital in the city of Buenos Aires].

Rev Argent Microbiol

December 2024

Departamento de Bioquímica Clínica, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, Hospital de Clínicas «José de San Martín», Buenos Aires, Argentina. Electronic address:

Aeromonas spp. are opportunistic pathogens that cause both intra- and extraintestinal infections. The objective of this work was the phenotypic and genotypic characterization of a collection of Aeromonas strains, in addition to determining their sensitivity to different antimicrobials.

View Article and Find Full Text PDF

Want AI Summaries of new PubMed Abstracts delivered to your In-box?

Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!