First Report of Cherry green ring mottle virus in Plum (Prunus domestica) in North America.

Cherry green ring mottle virus (CGRMV), a member of the genus Foveavirus, is reported to infect several Prunus species including sour cherry (Prunus cerasus L.), sweet cherry (P. avium L.), flowering cherry (P. serrulata L.), peach (P. persica B.), and apricot (P. armeniaca L.). The virus has been detected in most regions of North America, Europe, New Zealand, Africa, and Japan where Prunus species are grown for production (3). In sour cherry, the virus causes leaf yellowing and dark mottle around secondary veins. Other Prunus species are usually symptomless hosts of CGRMV. There is no report on the infection of CGRMV in plum so far. A survey was conducted to evaluate the sanitary status of stone fruit tree collections in the Canadian Clonal Genebank (CCG) at the Greenhouse and Processing Crops Research Center (GPCRC) in Harrow, Ontario (Canada). In October 2006, samples from 110 cultivar clones including 28 sweet cherry, 36 sour cherry, 12 hybrids, and 34 plum accessions, were bud grafted onto indicator seedlings of P. serrulata 'Kwanzan' for virus indexing in a greenhouse with a controlled environment. In April 2007, symptoms of epinasty and/or rusty necrotic fragments of midrib, which is indicative of Kwanzan infection by CGRMV (4), were observed on indicator plants inoculated with samples from eight clones (one sweet cherry, one cherry plum (P. besseyi × P. hortulana) and six plum). Indicator plants inoculated with samples from 19 other clones (three sweet cherry, nine sour cherry, one cherry plum and six plum) showed symptoms including small leaves and leaves that were twisted, deformed, bubbled, and/or had shot holes. Total RNA was extracted from leaves of all these symptomatic indicator plants by the cetyltrimethylammoniumbromide (CTAB) method (2). One-step reverse transcription (RT)-PCR was carried out using the primer set CGRMV1 (CCTCATTCACATAGCTTAGGTTT, 7,297 to 7,313 bp) and CGRMV2 (ACTTTAGCTTCGCCCCGTG, 8,245 to 8,227 bp) (1) for the detection of CGRMV. Amplicons of the expected size of 948 bp were consistently produced from eight samples showing symptoms of CGRMV infection, no amplicons were produced from the other 19 samples. Those results were further confirmed by RT-PCR detection for the original field samples. The fragment from plum cv. Vanier was cloned into pGEM-T Easy and sequenced in both directions of three clones. The resulting nucleotide sequence (GenBank Accession No. FJ402843) had the highest identity (97%) with that of a CGRMV isolate Star from sweet cherry (GenBank Accession No. AY841279) and had lower identity (81%) with that of a CGRMV isolate from apricot (GenBank Accession No. AY172334.1). To our knowledge, this is the first report of CGRMV infecting plum in North America. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. Plant Dis. 88:12, 2004. (3) K. G. Parker et al. USDA Agric. Handb. No. 437:193, 1976. (4) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.