Background: Rotavirus is the leading cause of acute gastroenteritis in children and is associated with neurological complications such as seizures and encephalopathy. The aim of this study was to investigate the presentation and complications of rotavirus compared to non-rotavirus gastroenteritis in UK children.

Methods: This was a retrospective, case-control, hospital-based study conducted at three sites in east London, UK. Cases were children aged 1 month to 16 years diagnosed with acute gastroenteritis between 1 June 2011 and 31 December 2013, in whom stool virology investigations confirmed presence of rotavirus by PCR. They were matched by age, gender and month of presentation to controls with rotavirus-negative gastroenteritis.

Results: Data were collected from 116 children (50 cases and 66 controls). Children with rotavirus gastroenteritis tended to present more frequently with metabolic acidosis (pH 7.30 vs 7.37, P = 0.011) and fever (74% versus 46%; P = 0.005) and were more likely to require hospitalisation compared to children with non-rotavirus gastroenteritis (93% versus 73%; P = 0.019). Neurological complications were the most common extra-intestinal manifestations, but did not differ significantly between children with rotavirus-positive gastroenteritis (RPG) and rotavirus-negative gastroenteritis (RNG) (24% versus 15%, respectively; P = 0.24). Encephalopathy occurred only in children with rotavirus infection (n = 3, 6%).

Conclusion: Rotavirus causes longer and more severe disease compared to other viral pathogens. Seizures and milder neurological signs were surprisingly common and associated with multiple pathogens, but encephalopathy occurred only in children with rotavirus gastroenteritis. Rotavirus vaccination may reduce seizures and presentation to hospital, but vaccines against other pathogens causing gastroenteritis are required.

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC5863974PMC
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0194009PLOS

Publication Analysis

Top Keywords

rotavirus gastroenteritis
12
children rotavirus
12
gastroenteritis
10
rotavirus
9
children
9
complications rotavirus
8
gastroenteritis children
8
east london
8
retrospective case-control
8
acute gastroenteritis
8

Similar Publications

First identification and whole genome characterization of rotavirus C in pigs in Zambia.

Virology

December 2024

Institute for Vaccine Research and Development, Hokkaido University, Sapporo, 001-0021, Japan; Department of Disease Control, School of Veterinary Medicine, The University of Zambia, Lusaka, 10101, Zambia; One Health Research Center, Hokkaido University, Sapporo, 060-0818, Japan; International Collaboration Unit, International Institute for Zoonosis Control, Hokkaido University, Sapporo, 001-0020, Japan; Africa Center of Excellence for Infectious Diseases of Humans and Animals, The University of Zambia, Lusaka, 10101, Zambia. Electronic address:

Rotavirus C (RVC) causes acute gastroenteritis in neonatal piglets. Despite the clinical importance of RVC infection, the distribution and prevalence in pig populations in most African countries remains unknown. In this study, we identified RVC in Zambian pigs by metagenomic analysis.

View Article and Find Full Text PDF

Rotavirus, a leading cause of severe acute gastroenteritis in children, is largely preventable through immunization with two internationally licensed oral rotavirus vaccines (RVVs) included in national programs across over 100 countries. These RVVs are administered in either two (Rotarix™; 2D-RV) or three (RotaTeq®; 3D-RV) doses. We aimed to assess the global coverage, completion, and compliance of 2D-RV and 3D-RV in various settings, and to identify factors influencing vaccine coverage.

View Article and Find Full Text PDF

Rotavirus vaccine appears to perform sub-optimally in countries with higher rotavirus burden. We hypothesized that differences in the magnitude of rotavirus exposures may bias vaccine efficacy (VE) estimates, so true differences in country-specific rotavirus VE would be exaggerated without accommodating differences in exposure. We estimated VE against any-severity and severe rotavirus gastroenteritis (RVGE) using Poisson regression models fit to pooled individual-level data from Phase II and III monovalent rotavirus vaccine trials conducted between 2000 and 2012.

View Article and Find Full Text PDF
Article Synopsis
  • Human norovirus leads globally in causing stomach infections across all ages.
  • A new detection method using time-resolved fluorescence microsphere immunochromatography was developed, maximizing sensitivity and speed for identifying the VP1 protein of norovirus GII in only 15 minutes.
  • The method displays high accuracy with a 96.60% overall coincidence rate in clinical samples, indicating its potential for quick and effective diagnostics in healthcare settings.
View Article and Find Full Text PDF

Development of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A.

Mol Biotechnol

December 2024

Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.

The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.

View Article and Find Full Text PDF

Want AI Summaries of new PubMed Abstracts delivered to your In-box?

Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!