Introduction of novel α-hemoglobin gene mutation with transfusion-dependent phenotype.

Objective And Importance: Thalassemia is the most frequently monogenetic disorders around the world that is inherited as a recessive single-gene disease, resulting from mutations in α- or β-globin gene clusters. The aim of this report was to present a new insertional mutation in the α globin gene which causes transfusion-dependent anemia in α-thalassemic patients.

Clinical Presentation: Two 5-year-old girls with blood transfusion-dependent α-thalassemia anemia and another girl with moderate α-thalassemia have been presented among patients who have been referred to Hematology and Thalassemia Research Center, Dastgheib Hospital, Shiraz, Iran. They were not relatives. All children were stunted and pale; they were put on regular blood transfusion every 14-21 days.

Intervention: Sequencing of the β-globin gene was normal in all cases and their parents; but, α-globin gene sequencing results were remarkable. An insertion of 21 base pairs (IVS II+3ins (+21nt)(+GACCCGGTCAACTTCAAGGTG) in the α-globin gene was detected in all three cases and one of their parents. In two cases, this insertion was accompanied by MED deletion and in one child by POLY A mutation. MED deletion was detected by gap-PCR.

Conclusion: This new 21 base pair insertion cannot affect blood parameters on its own, but can present as continuous blood transfusion-dependent α-thalassemia. Thus, it is important to take this point into account for detecting the carriers, like β-thalassemia carriers, which can present as transfusion-dependent children in parents with α-thalassemia trait.