The sequence of the 5'-terminal 74 nucleotides of alfalfa mosaic virus RNA 4, the mRNA for the viral coat protein, has been deduced by using various new techniques for labeling the RNA at the 5' end with 32P and for sequencing the 5'-32P-labeled RNA. The sequence is NpppGUUUUUAUUUUUAAUUUUCUUUCAAAUACUUCCAUCAUGAGUUCUUCACAAAAGAAAGCUGGUGGGAAAGCUGG. The AUG initiator codon is located 36 nucleotides in from the 5' end; the nucleotide sequence beyond corresponds to the amino acid sequence of the coat protein. This 5' noncoding region is rich in U (58% U); except for the 5'-terminal G, the next G in is part of the initiator AUG codon.
Download full-text PDF |
Source |
---|---|
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC431782 | PMC |
http://dx.doi.org/10.1073/pnas.74.12.5504 | DOI Listing |
Adv Healthc Mater
January 2025
Department of Orthopedic Surgery, The First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, 310003, China.
Characterized by a cascade of profound changes in nucleus pulposus (NP) cells, extracellular matrix (ECM), and biomechanics, intervertebral disc degeneration is a common multifactorial condition that may lead to various degenerative lumbar disorders. Therapeutic strategies targeting a single factor have shown limited efficacy in treating disc degeneration, and approaches that address multiple pathological ingredients are barely reported. In this study, engineered cell membrane-encapsulated keratin nanoparticles are developed to simultaneously alleviate NP cell senescence and promote ECM remodeling.
View Article and Find Full Text PDFPlant Dis
January 2025
Cornell University, Ithaca, New York, United States;
Azerbaijan is major producer of fruit crops, such as pome and stone fruits, in the Caspian Sea and Caucasus Mountains areas (FAO Stat, 2022). No information is available on the occurrence of apple chlorotic leaf spot virus (ACLSV, genus Trichovirus, family Betaflexiviridae) in the country. Therefore, the main fruit tree production areas in Azerbaijan were surveyed for ACLSV during the 2017-2019 growing seasons by DAS-ELISA using ACLSV reagents (Neogen - Scotland, UK) (Clark and Adams 1977).
View Article and Find Full Text PDFMethods Enzymol
January 2025
Area of Bioscience and Biotechnology, School of Materials Science, Japan Advanced Institute of Science and Technology, Asahidai, Nomicity, Ishikawa, Japan. Electronic address:
Site-directed RNA editing (SDRE) holds significant promise for treating genetic disorders resulting from point mutations. Gene therapy, for common genetic illnesses is becoming more popular and, although viable treatments for genetic disorders are scarce, stop codon mutation-related conditions may benefit from gene editing. Effective SDRE generally depends on introducing many guideRNA molecules relative to the target gene; however, large ratios cannot be achieved in the context of gene therapy applications.
View Article and Find Full Text PDFACS Omega
January 2025
School of Life Sciences, Beijing University of Chinese Medicine, Beijing 102488, China.
In phage display technology, exogenous DNA is inserted into the phage genome, which generates a fusion protein with the phage coat protein, facilitates expression and promotes biological activity. This approach is primarily used to screen antibody libraries owing to its high library capacity and fast technical cycle; additionally, various types of genetically altered antibodies can be easily produced. In this study, we fused the pIII structural protein of the M13K07 phage with a scFv created by connecting the VH and VL domains of an anti-IFN-γ antibody.
View Article and Find Full Text PDFBMC Genomics
January 2025
College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi, 712100, China.
Background: Rex rabbit is famous for its silky and soft fur coat, a characteristic predominantly attributed to its hair follicles. Numerous studies have confirmed the crucial roles of mRNAs and non-coding RNAs (ncRNAs) in regulating key cellular processes such as cell proliferation, differentiation, apoptosis and immunity. However, their involvement in the regulation of the hair cycle in Rex rabbits remains unknown.
View Article and Find Full Text PDFEnter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!