Performance of several library search algorithms (against EI mass spectral databases) implemented in commercial software products ( acd/specdb, chemstation, gc/ms solution and ms search) was estimated. Test set contained 1000 mass spectra, which were randomly selected from NIST'08 (RepLib) mass spectral database. It was shown that composite (also known as identity) algorithm implemented in ms search (NIST) software gives statistically the best results: the correct compound occupied the first position in the list of possible candidates in 81% of cases; the correct compound was within the list of top ten candidates in 98% of cases. It was found that use of presearch option can lead to rejection of the correct answer from the list of possible candidates (therefore presearch option should not be used, if possible). Overall performance of library search algorithms was estimated using receiver operating characteristic curves.
Download full-text PDF |
Source |
|---|---|
| http://dx.doi.org/10.1002/jms.3591 | DOI Listing |
Publication Analysis
Top Keywords
Similar Publications
NovoRank: Refinement for Peptide Sequencing Based on Spectral Clustering and Deep Learning.
J Proteome Res
December 2024
Department of Artificial Intelligence, Hanyang University, Seoul 04763, Republic of Korea.
peptide sequencing is a valuable technique in mass-spectrometry-based proteomics, as it deduces peptide sequences directly from tandem mass spectra without relying on sequence databases. This database-independent method, however, relies solely on imperfect scoring functions that often lead to erroneous peptide identifications. To boost correct identification, we present NovoRank, a postprocessing tool that employs spectral clustering and machine learning to assign more plausible peptide sequences to spectra.
View Article and Find Full Text PDFDevelopment of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A.
Mol Biotechnol
December 2024
Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.
The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.
View Article and Find Full Text PDFRevealing O-acetylhomoserine sulfhydrylase involved in direct sulfhydrylation pathway in Clostridium tetani.
Biochimie
December 2024
Engelhardt Institute of Molecular Biology of the Russian Academy of Sciences, 32 Vavilov St., Moscow 119991, Russia.
Bacterial methionine biosynthesis is an attractive target for research due to its central role in cellular metabolism, as most steps of this pathway are missing in mammals. Up to now little is known about sulfur metabolism in pathogenic Clostridia species, making the study of the enzymes of Cys/Met metabolism in Clostridium tetani particularly relevant. Analysis of the C.
View Article and Find Full Text PDFImplications of cosmologically coupled black holes for pulsar timing arrays.
Sci Rep
December 2024
Department of Physics, University of Trento, Via Sommarive 14, 38123, Povo (TN), Italy.
It has been argued that realistic models of (singularity-free) black holes (BHs) embedded within an expanding Universe are coupled to the large-scale cosmological dynamics, with striking consequences, including pure cosmological growth of BH masses. In this pilot study, we examine the consequences of this growth for the stochastic gravitational wave background (SGWB) produced by inspiraling supermassive cosmologically coupled BHs. We show that the predicted SGWB amplitude is enhanced relative to the standard uncoupled case, while maintaining the [Formula: see text] frequency scaling of the spectral energy density.
View Article and Find Full Text PDFComprehensive Mass Spectral Libraries of Human Thyroid Tissues and Cells.
Sci Data
December 2024
Westlake Center for Intelligent Proteomics, Westlake Laboratory of Life Sciences and Biomedicine, No. 18 Shilongshan Road, Hangzhou, 310024, China.
Thyroid nodules are a common endocrine condition with an increasing incidence over the decades. Data-independent acquisition has been widely utilized in discovery proteomics to identify disease biomarkers and therapeutic targets. To analyze the thyroid disease-related proteome in a high-throughput, reproducible and reliable manner, we introduce thyroid-specific peptide spectral libraries.
View Article and Find Full Text PDFWant AI Summaries of new PubMed Abstracts delivered to your In-box?
Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!