Background: The PCR technique and its variations have been increasingly used in the clinical laboratory and recent advances in this field generated new higher resolution techniques based on nucleic acid denaturation dynamics. The principle of these new molecular tools is based on the comparison of melting profiles, after denaturation of a DNA double strand. Until now, the secondary structure of single-stranded nucleic acids has not been exploited to develop identification systems based on PCR. To test the potential of single-strand RNA denaturation as a new alternative to detect specific nucleic acid variations, sequences from viruses of the Totiviridae family were compared using a new in silico melting curve approach. This family comprises double-stranded RNA virus, with a genome constituted by two ORFs, ORF1 and ORF2, which encodes the capsid/RNA binding proteins and an RNA-dependent RNA polymerase (RdRp), respectively.
Results: A phylogenetic tree based on RdRp amino acid sequences was constructed, and eight monophyletic groups were defined. Alignments of RdRp RNA sequences from each group were screened to identify RNA regions with conserved secondary structure. One region in the second half of ORF2 was identified and individually modeled using the RNAfold tool. Afterwards, each DNA or RNA sequence was denatured in silico using the softwares MELTSIM and RNAheat that generate melting curves considering the denaturation of a double stranded DNA and single stranded RNA, respectively. The same groups identified in the RdRp phylogenetic tree were retrieved by a clustering analysis of the melting curves data obtained from RNAheat. Moreover, the same approach was used to successfully discriminate different variants of Trichomonas vaginalis virus, which was not possible by the visual comparison of the double stranded melting curves generated by MELTSIM.
Conclusion: In silico analysis indicate that ssRNA melting curves are more informative than dsDNA melting curves. Furthermore, conserved RNA structures may be determined from analysis of individuals that are phylogenetically related, and these regions may be used to support the reconstitution of their phylogenetic groups. These findings are a robust basis for the development of in vitro systems to ssRNA melting curves detection.
Download full-text PDF |
Source |
---|---|
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4119202 | PMC |
http://dx.doi.org/10.1186/1471-2105-15-243 | DOI Listing |
Acta Parasitol
January 2025
Department of Veterinary Medicine, Federal University of Paraná, Rua Dos Funcionários, 1540, Curitiba, Paraná, 80035-050, Brazil.
Purpose: The aim of the present study was to establish a SYBR Green-based real-time PCR assay for detection of the Nc5 segment from the Neospora caninum genome.
Methods: The oligonucleotides sequences targeting the Nc5 gene previously reported and designed in-house were validated. Two Primer sets were evaluated and tested in four different combinations.
Phys Rev Lett
December 2024
European Synchrotron Radiation Facility (ESRF), 71 Avenue des Martyrs, Grenoble, CS 40220, 38043, France.
Studying the properties and phase diagram of iron at high-pressure and high-temperature conditions has relevant implications for Earth's inner structure and dynamics and the temperature of the inner core boundary (ICB) at 330 GPa. Also, a hexagonal-closed packed to body-centered cubic (bcc) phase transition has been predicted by many theoretical works but observed only in a few experiments. The recent coupling of high-power laser with advanced x-ray sources from synchrotrons allows for novel approaches to address these issues.
View Article and Find Full Text PDFEnviron Sci Pollut Res Int
January 2025
Department of Civil, Geological, and Environmental Engineering, College of Engineering, University of Saskatchewan, 57 Campus Drive, Engineering Building, Saskatoon, SK, S7N 5A9, Canada.
Extending unfrozen water availability is critical for stress-tolerant bioremediation of contaminated soils in cold climates. This study employs the soil-freezing characteristic curves (SFCCs) of biostimulated, hydrocarbon-contaminated cold-climate soils to efficiently address the coupled effects of unfrozen water retention and freezing soil temperature on sub-zero soil respiration activity. Freezing-induced soil respiration experiments were conducted under the site-relevant freezing regime, programmed from 4 to - 10 °C at a seasonal soil-freezing rate of - 1 °C/day.
View Article and Find Full Text PDFInfect Dis Clin Microbiol
December 2024
Department of Infectious Diseases and Clinical Microbiology, İstanbul University-Cerrahpaşa, Cerrahpaşa School of Medicine, İstanbul, Türkiye.
Objective: Early diagnosis and treatment of candidemia in intensive care units (ICUs) remain a significant challenge globally because of the lack of well-established non-culture-based diagnostic methods. This study aimed to evaluate risk factors in critically ill ICU patients, develop a unique score, and create a real-time polymerase chain reaction (PCR) assay for the early diagnosis of candidemia.
Materials And Methods: The study was conducted in three phases: 1) Retrospective analysis of 100 ICU patients from İstanbul University-Cerrahpaşa between January 2017 and December 2018 to identify risk factors for invasive candidiasis, 2) development of Cerrahpaşa score based on these findings, and 3) prospective evaluation of 75 ICU patients, applying the newly created Cerrahpaşa score and implementing a rapid PCR-based test on whole blood samples.
Mol Biotechnol
December 2024
Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.
The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.
View Article and Find Full Text PDFEnter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!