The unique ability of triplex-forming PNAs to invade the double helix has made it possible to develop a highly specific and sensitive approach for bacterial detection. The method uses short, about 20-bp-long, signature sequences presented as a single copy in the bacterial genome. Bacterial cells are fixed on slides and the PD-loop structure is assembled on the signature site with the help of PNA openers, which includes the circular probe. The sensitivity of the method is achieved via Rolling Circle Amplification (RCA) of the circular probe. The obtained amplicon is detected using short ssDNA decorator probes carrying fluorophores and via standard fluorescent microscopy.
Download full-text PDF |
Source |
|---|---|
| http://dx.doi.org/10.1007/978-1-62703-553-8_10 | DOI Listing |
Publication Analysis
Top Keywords
Similar Publications
Protective effect of modafinil on skin flap survival in the experimental random-pattern skin flap model in rats: The role of ATP-sensitive potassium channels and nitric oxide pathway.
J Plast Reconstr Aesthet Surg
June 2021
Experimental Medicine Research Center, Tehran University of Medical Sciences, Tehran, Iran; Department of Pharmacology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran. Electronic address:
Background: The brain-stimulating agent modafinil acts through nitric oxide (NO) and adenosine triphosphate (ATP)-sensitive potassium (K) channels, involved in the skin flap survival (SFS). The main aim of this study was to investigate the efficacy of modafinil on SFS in rats through the involvement of NO pathway and K channels.
Methods: Using controlled experiment study design, we enrolled a sample of Wistar male rats.
Target DNA detection and quantitation on a single cell with single base resolution.
Technology (Singap World Sci)
September 2013
In this report, we present a new method for sensitive detection of short DNA sites in single cells with single base resolution. The method combines peptide nucleic acid (PNA) openers as the tagging probes, together with isothermal rolling circle amplification (RCA) and fluorescence-based detection, all performed in a cells-in-flow format. Bis-PNAs provide single base resolution, while RCA ensures linear signal amplification.
View Article and Find Full Text PDFPNA openers and their applications for bacterial DNA diagnostics.
Methods Mol Biol
July 2014
Department of Biomedical Engineering, Boston University, Boston, USA.
The unique ability of triplex-forming PNAs to invade the double helix has made it possible to develop a highly specific and sensitive approach for bacterial detection. The method uses short, about 20-bp-long, signature sequences presented as a single copy in the bacterial genome. Bacterial cells are fixed on slides and the PD-loop structure is assembled on the signature site with the help of PNA openers, which includes the circular probe.
View Article and Find Full Text PDFApplication of PNA openers for fluorescence-based detection of bacterial DNA.
Methods Mol Biol
March 2014
Department of Biomedical Engineering, Boston University, Boston, MA, USA.
Peptide nucleic acid (PNA) openers have the unique ability to invade double-stranded DNA with high efficiency and sequence specificity, making it possible to detect short (about 20 bp), single-copy bacterial DNA sequences. PNA openers bind to a target signature site on one strand of bacterial DNA, leaving the other strand open for hybridization with a circularizable oligonucleotide probe. The assembled complex serves as a template for rolling circle amplification.
View Article and Find Full Text PDFTargeting G-quadruplex structure in the human c-Kit promoter with short PNA sequences.
Bioconjug Chem
April 2011
Dipartimento di Chimica delle Sostanze Naturali, Università degli Studi di Napoli Federico II, via D. Montesano 49, 80131, Napoli, Italy.
The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K(+)- or NH(4)(+)-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies.
View Article and Find Full Text PDFWant AI Summaries of new PubMed Abstracts delivered to your In-box?
Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!