Background: Aquareovirus particle is comprised of central core and outer capsid, which is built by seven structural proteins (VP1-VP7). The protein VP6 has been identified to be a clamp protein of stabilizing inner core frame VP3, and bridging outer shell protein VP5. However, the biological properties of VP6 in viral life cycle remain unknown.
Results: The recombinant VP6 (rVP6) of aquareovirus was expressed in E. coli, and the polyclonal antibody against VP6 was generated by using purified rVP6 in this study. Following the preparation of VP6 antibody, the VP6 component in aquareovirus infected cells and purified viral particles was detected by Immunoblotting (IB) assay. Furthermore, using Immunofluorescence (IF) microscopy, singly transfected VP6 protein was observed to exhibit a diffuse distribution mainly in the cytoplasm, while it appeared inclusion phenotype in infected cells. Meanwhile, inclusion structures were also identified when VP6 was coexpressed with nonstructural protein NS80 in cotransfected cells.
Conclusions: VP6 can be recruited by NS80 to its inclusions in both infected and transfected cells. The colocalization of VP6 and NS80 is corresponding to their homologous proteins σ2 and μNS in MRV. Our results suggest that VP6 may play a significant role in viral replication and particle assembly.
Download full-text PDF |
Source |
|---|---|
| http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3660289 | PMC |
| http://dx.doi.org/10.1186/1743-422X-10-133 | DOI Listing |
Publication Analysis
Top Keywords
Similar Publications
Development of a Quadruplex RT-qPCR for the Detection of Porcine Astrovirus, Porcine Sapovirus, Porcine Norovirus, and Porcine Rotavirus A.
Pathogens
November 2024
College of Animal Science and Technology, Guangxi University, Nanning 530005, China.
Porcine astrovirus (PoAstV), porcine sapovirus (PoSaV), porcine norovirus (PoNoV), and porcine rotavirus A (PoRVA) are newly discovered important porcine diarrhea viruses with a wide range of hosts and zoonotic potential, and their co-infections are often found in pig herds. In this study, the specific primers and probes were designed targeting the ORF1 gene of PoAstV, PoSaV, and PoNoV, and the VP6 gene of PoRVA. The recombinant standard plasmids were constructed, the reaction conditions (concentration of primers and probes, annealing temperature, and reaction cycle) were optimized, and the specificity, sensitivity, and reproducibility were analyzed to establish a quadruplex real-time quantitative RT-PCR (RT-qPCR) assay for the detection of these four diarrheal viruses.
View Article and Find Full Text PDFDevelopment of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A.
Mol Biotechnol
December 2024
Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.
The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.
View Article and Find Full Text PDFDevelopment of a Dual-Epitope Nanobody-Based Immunosensor with MXenes@CNTs@AuNPs for Ultrasensitive Detection of Rotavirus.
Anal Chem
December 2024
State Key Laboratory of Pollution Control and Resource Reuse, School of the Environment, Nanjing University, Nanjing 210093, China.
Article Synopsis
- Traditional immunoassays for detecting viruses are expensive and fragile, prompting the development of more robust alternatives using engineered nanobodies.
- The new nanobodies were combined into a sandwich immunosensor, allowing for highly sensitive detection of rotaviruses in different samples and outperforming existing commercial kits.
- This advanced sensor also demonstrates excellent performance in terms of specificity, stability, and accuracy, making it a promising option for reliable viral detection in multiple environments.
Background: Rotaviruses are the major etiological agents of gastroenteritis and diarrheal outbreaks in plenty of mammalian species. The genus Rotavirus is highly diverse and currently comprises nine genetically distinct species, and four of them (A, B, C, and H) are common for humans and pigs. There is a strong necessity to comprehend phylogenetic relationships among rotaviruses from different host species to assess interspecies transmission, specifically between humans and livestock.
View Article and Find Full Text PDFEscherichia coli heat-labile enterotoxin B subunit as an adjuvant of mucosal immune combined with GCRV-II VP6 triggers innate immunity and enhances adaptive immune responses following oral vaccination of grass carp (Ctenopharyngodon idella).
Fish Shellfish Immunol
November 2024
Pearl River Fishery Research Institute, Chinese Academy of Fishery Sciences, Key Laboratory of Fishery Drug Development, Ministry of Agriculture and Rural Affairs, Guangdong Provincial Key Laboratory of Aquatic Animal Immunology and Sustainable Aquaculture, Guangzhou, 510380, China. Electronic address:
Article Synopsis
- The grass carp reovirus (GCRV) significantly jeopardizes the grass carp industry in China, necessitating the development of more effective vaccines beyond the current oral vaccines that fail to provide full protection.
- Researchers combined the heat-labile enterotoxin B subunit (LTB) from E. coli with a protective antigen from GCRV-II to create a new oral vaccine, which they tested on the rare minnow model to assess immune response and protective efficacy.
- Results showed that this new combination vaccine with LTB led to stronger immune responses, including higher antibody levels and improved adaptive immunity, ultimately increasing the survival rate of fish during GCRV infection, suggesting LTB's potential as a valuable adjuvant in fish
Want AI Summaries of new PubMed Abstracts delivered to your In-box?
Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!