Prion infections, causing neurodegenerative conditions such as Creutzfeldt-Jakob disease and kuru in humans, scrapie in sheep and BSE in cattle are characterised by prolonged and variable incubation periods that are faithfully reproduced in mouse models. Incubation time is partly determined by genetic factors including polymorphisms in the prion protein gene. Quantitative trait loci studies in mice and human genome-wide association studies have confirmed that multiple genes are involved. Candidate gene approaches have also been used and identified App, Il1-r1 and Sod1 as affecting incubation times. In this study we looked for an association between App, Il1-r1 and Sod1 representative SNPs and prion disease incubation time in the Northport heterogeneous stock of mice inoculated with the Chandler/RML prion strain. No association was seen with App, however, significant associations were seen with Il1-r1 (P = 0.02) and Sod1 (P<0.0001) suggesting that polymorphisms at these loci contribute to the natural variation observed in incubation time. Furthermore, following challenge with Chandler/RML, ME7 and MRC2 prion strains, Sod1 deficient mice showed highly significant reductions in incubation time of 20, 13 and 24%, respectively. No differences were detected in Sod1 expression or activity. Our data confirm the protective role of endogenous Sod1 in prion disease.

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3551847PMC
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0054454PLOS

Publication Analysis

Top Keywords

incubation time
12
mouse models
8
prion disease
8
app il1-r1
8
il1-r1 sod1
8
association app
8
incubation
5
prion
5
sod1
4
sod1 deficiency
4

Similar Publications

Two marine-derived bacteria, Bacillus paralicheniformis (HR-1) and Bacillus haynesii (HR-5), were isolated from sediments and identified using 16S ribosomal RNA gene amplification and sequencing as well as biochemical analysis. The development of a bacterial consortium (HR-1 & HR-5) from these two bacteria was used to increase the production of the protease enzyme under various conditions, including fermentation media, carbon and nitrogen sources (1% w/v), different pH levels, incubation time, and the obtained enzyme, were detected using SDS-PAGE followed by purification. Bacterial consortium HR-1 & HR-5 exhibited maximum protease production (330.

View Article and Find Full Text PDF

Development of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A.

Mol Biotechnol

December 2024

Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.

The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.

View Article and Find Full Text PDF

Encapsulation of paclitaxel into date palm lipid droplets for enhanced brain cancer therapy.

Sci Rep

December 2024

Department of Molecular Biology and Biotechnology, Atomic Energy Commission of Syria (AECS), P.O. Box 6091, Damascus, Syria.

Paclitaxel, a powerful anticancer drug, is limited by its poor water solubility and systemic toxicity, which hinder its effectiveness against aggressive brain tumors. This study aims to overcome these challenges by exploring novel intranasal delivery methods using lipid droplets (LDs) derived from date palm seeds (DPLDs) and mouse liver (MLLDs). The anticancer efficacy of PTX was evaluated using a comparative intranasal delivery approach.

View Article and Find Full Text PDF

The major barrier to the wide-range application of biosurfactants is their high cost of production and low yield. In this study, waste frying oil (WFO) was used as the sole carbon source to produce cost-effective and eco-friendly rhamnolipids by Halopseudomonas sabulinigri OZK5 isolated from crude oil-contaminated soil samples. The optimal culture conditions for rhamnolipid production were determined as 30 ml/l waste frying oil, 37 °C temperature, pH 8, and 72 h incubation time.

View Article and Find Full Text PDF

The research used bacterial biosensors containing bacterial luciferase genes to monitor changes in the environment in real-time. In this work to express four different gene constructs: recA:luxCDABE, soxS:luxCDABE, micF:luxCDABE, and rpoB:luxCDABE in Escherichia coli SM lux biosensor after exposure to three different antibiotics (nalidixic acid, ampicillin, kanamycin) and diclofenac was determined. It was found that incubation of the E.

View Article and Find Full Text PDF

Want AI Summaries of new PubMed Abstracts delivered to your In-box?

Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!