Stability and mismatch discrimination of locked nucleic acid-DNA duplexes.

Biochemistry

Department of Molecular Genetics and Biophysics, Integrated DNA Technologies, Coralville, Iowa 52241, United States.

Published: November 2011

AI Article Synopsis

  • Locked nucleic acids (LNAs) improve the stability and specificity of synthesized oligonucleotides by altering thermodynamic parameters, which include favorable enthalpic changes but unfavorable entropy loss during the single strand-duplex transition.
  • New guidelines for designing LNA oligonucleotides and a free online software tool are introduced to help predict the stability of LNA duplexes.
  • Mismatch discrimination varies significantly depending on the type of mismatch and surrounding base pairs, with some sequences benefiting from LNAs while others may experience reduced specificity, suggesting a shift in duplex conformation influences mismatch discrimination.

Article Abstract

Locked nucleic acids (LNA; symbols of bases, +A, +C, +G, and +T) are introduced into chemically synthesized oligonucleotides to increase duplex stability and specificity. To understand these effects, we have determined thermodynamic parameters of consecutive LNA nucleotides. We present guidelines for the design of LNA oligonucleotides and introduce free online software that predicts the stability of any LNA duplex oligomer. Thermodynamic analysis shows that the single strand-duplex transition is characterized by a favorable enthalpic change and by an unfavorable loss of entropy. A single LNA modification confines the local conformation of nucleotides, causing a smaller, less unfavorable entropic loss when the single strand is restricted to the rigid duplex structure. Additional LNAs adjacent to the initial modification appear to enhance stacking and H-bonding interactions because they increase the enthalpic contributions to duplex stabilization. New nearest-neighbor parameters correctly forecast the positive and negative effects of LNAs on mismatch discrimination. Specificity is enhanced in a majority of sequences and is dependent on mismatch type and adjacent base pairs; the largest discriminatory boost occurs for the central +C·C mismatch within the +T+C+C sequence and the +A·G mismatch within the +T+A+G sequence. LNAs do not affect specificity in some sequences and even impair it for many +G·T and +C·A mismatches. The level of mismatch discrimination decreases the most for the central +G·T mismatch within the +G+G+C sequence and the +C·A mismatch within the +G+C+G sequence. We hypothesize that these discrimination changes are not unique features of LNAs but originate from the shift of the duplex conformation from B-form to A-form.

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3201676PMC
http://dx.doi.org/10.1021/bi200904eDOI Listing

Publication Analysis

Top Keywords

mismatch discrimination
12
locked nucleic
8
mismatch
7
lna
5
duplex
5
stability mismatch
4
discrimination
4
discrimination locked
4
nucleic acid-dna
4
acid-dna duplexes
4

Similar Publications

In this article, we present an approach to maximizing the splicing regulatory properties of splice-switching oligonucleotide (SSO) designed to regulate alternative splicing of PKM pre-mRNA. The studied SSO interacts with the regulatory element in exon 10 of PKM pre-mRNA and contributes to a significant reduction of PKM2 level with a simultaneous increase of the PKM1 isoform. This SSO forms a duplex not only with the regulatory fragment of exon 10 but also with a similar RNA fragment of intron 9.

View Article and Find Full Text PDF

Background: Attention-deficit/hyperactivity disorder (ADHD) patients exhibit characteristics of impaired working memory (WM) and diminished sensory processing function. This study aimed to identify the neurophysiologic basis underlying the association between visual WM and auditory processing function in children with ADHD.

Methods: The participants included 86 children with ADHD (aged 6-15 years, mean age 9.

View Article and Find Full Text PDF

Background/objectives: Previous studies have examined the role of working memory in cognitive tasks such as syntactic, semantic, and phonological processing, thereby contributing to our understanding of linguistic information management and retrieval. However, the real-time processing of phonological information-particularly in relation to suprasegmental features like tone, where its contour represents a time-varying signal-remains a relatively underexplored area within the framework of Information Processing Theory (IPT). This study aimed to address this gap by investigating the real-time processing of similar tonal information by native Cantonese speakers, thereby providing a deeper understanding of how IPT applies to auditory processing.

View Article and Find Full Text PDF

Intelligibility Sound Therapy Enhances the Ability of Speech-in-Noise Perception and Pre-Perceptual Neurophysiological Response.

Biology (Basel)

December 2024

Department of Otorhinolaryngology, Head and Neck Surgery, Graduate School of Biomedical Sciences, Hiroshima University, Kasumi 1-2-3, Minami-ku, Hiroshima 734-8551, Japan.

Aural rehabilitation with hearing aids can decrease the attentional requirements of cognitive resources by amplifying deteriorated-frequency sound in hearing loss patients and improving auditory discrimination ability like speech-in-noise perception. As aural rehabilitation with an intelligible-hearing sound also can be hopeful, the aim of this study was to evaluate the effectiveness of aural rehabilitation with intelligible-hearing sound for hearing loss patients. Adult native Japanese speakers (17 males and 23 females, 68.

View Article and Find Full Text PDF

Development of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A.

Mol Biotechnol

December 2024

Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.

The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.

View Article and Find Full Text PDF

Want AI Summaries of new PubMed Abstracts delivered to your In-box?

Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!