Locked nucleic acids (LNA; symbols of bases, +A, +C, +G, and +T) are introduced into chemically synthesized oligonucleotides to increase duplex stability and specificity. To understand these effects, we have determined thermodynamic parameters of consecutive LNA nucleotides. We present guidelines for the design of LNA oligonucleotides and introduce free online software that predicts the stability of any LNA duplex oligomer. Thermodynamic analysis shows that the single strand-duplex transition is characterized by a favorable enthalpic change and by an unfavorable loss of entropy. A single LNA modification confines the local conformation of nucleotides, causing a smaller, less unfavorable entropic loss when the single strand is restricted to the rigid duplex structure. Additional LNAs adjacent to the initial modification appear to enhance stacking and H-bonding interactions because they increase the enthalpic contributions to duplex stabilization. New nearest-neighbor parameters correctly forecast the positive and negative effects of LNAs on mismatch discrimination. Specificity is enhanced in a majority of sequences and is dependent on mismatch type and adjacent base pairs; the largest discriminatory boost occurs for the central +C·C mismatch within the +T+C+C sequence and the +A·G mismatch within the +T+A+G sequence. LNAs do not affect specificity in some sequences and even impair it for many +G·T and +C·A mismatches. The level of mismatch discrimination decreases the most for the central +G·T mismatch within the +G+G+C sequence and the +C·A mismatch within the +G+C+G sequence. We hypothesize that these discrimination changes are not unique features of LNAs but originate from the shift of the duplex conformation from B-form to A-form.
Download full-text PDF |
Source |
---|---|
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3201676 | PMC |
http://dx.doi.org/10.1021/bi200904e | DOI Listing |
RNA
December 2024
Instiute of Bioorganic Chemistry PAS
In this article, we present an approach to maximizing the splicing regulatory properties of splice-switching oligonucleotide (SSO) designed to regulate alternative splicing of PKM pre-mRNA. The studied SSO interacts with the regulatory element in exon 10 of PKM pre-mRNA and contributes to a significant reduction of PKM2 level with a simultaneous increase of the PKM1 isoform. This SSO forms a duplex not only with the regulatory fragment of exon 10 but also with a similar RNA fragment of intron 9.
View Article and Find Full Text PDFPsychol Med
January 2025
Guangzhou Medical University, The Affiliated Brain Hospital to Guangzhou Medical University, Guangzhou, China.
Background: Attention-deficit/hyperactivity disorder (ADHD) patients exhibit characteristics of impaired working memory (WM) and diminished sensory processing function. This study aimed to identify the neurophysiologic basis underlying the association between visual WM and auditory processing function in children with ADHD.
Methods: The participants included 86 children with ADHD (aged 6-15 years, mean age 9.
Brain Sci
December 2024
Faculty of Arts and Humanities, University of Macau, Macau SAR 999078, China.
Background/objectives: Previous studies have examined the role of working memory in cognitive tasks such as syntactic, semantic, and phonological processing, thereby contributing to our understanding of linguistic information management and retrieval. However, the real-time processing of phonological information-particularly in relation to suprasegmental features like tone, where its contour represents a time-varying signal-remains a relatively underexplored area within the framework of Information Processing Theory (IPT). This study aimed to address this gap by investigating the real-time processing of similar tonal information by native Cantonese speakers, thereby providing a deeper understanding of how IPT applies to auditory processing.
View Article and Find Full Text PDFBiology (Basel)
December 2024
Department of Otorhinolaryngology, Head and Neck Surgery, Graduate School of Biomedical Sciences, Hiroshima University, Kasumi 1-2-3, Minami-ku, Hiroshima 734-8551, Japan.
Aural rehabilitation with hearing aids can decrease the attentional requirements of cognitive resources by amplifying deteriorated-frequency sound in hearing loss patients and improving auditory discrimination ability like speech-in-noise perception. As aural rehabilitation with an intelligible-hearing sound also can be hopeful, the aim of this study was to evaluate the effectiveness of aural rehabilitation with intelligible-hearing sound for hearing loss patients. Adult native Japanese speakers (17 males and 23 females, 68.
View Article and Find Full Text PDFMol Biotechnol
December 2024
Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.
The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.
View Article and Find Full Text PDFEnter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!