Rotavirus is the single main cause of severe acute gastroenteritis in children less than 5 years of age, resulting in over 527,000 deaths worldwide annually. The majority of rotavirus-related deaths are seen in less-developed countries; in developed countries, rotavirus is an infrequent cause of death but a commom cause of hospitalizations. Rotavirus gastroenteritis was also estimated to result in approximately 790,000 doctor visits every year leading to medical intervention among children aged 0-5 years in Japan. At present, the treatment of rotavirus gastroenteritis in Japan is limited to symptomatic measures and no antiviral therapy is available. A phase III, randomized, double-blind study evaluated the efficacy, reactogenicity, safety and immunogenicity of a human rotavirus vaccine in Japanese infants. Rotavirus vaccine was efficacious, well-tolerated and immunogenic in Japanese infants and introduction of vaccination would help in reducing the disease burden.
Download full-text PDF |
Source |
---|
Anal Methods
January 2025
The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, People's Republic of China.
Human norovirus is the leading cause of non-bacterial gastroenteritis worldwide in all age groups. In this study, a rapid, high-sensitivity and quantitative detection method for VP1 protein of norovirus GII was developed based on time-resolved fluorescence microsphere immunochromatography. The optimal labeling amount and coated antibody concentration of norovirus monoclonal antibody were 10 μg and 1.
View Article and Find Full Text PDFMol Biotechnol
December 2024
Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.
The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.
View Article and Find Full Text PDFVaccine
December 2024
ICMR- National Institute for Research in Bacterial Infections (formerly ICMR-NICED), Kolkata, India. Electronic address:
Background: Despite global rotavirus vaccination efforts, rotavirus remains a leading cause of childhood deaths from acute gastroenteritis. Post-vaccination studies in India, particularly in eastern India, have been limited, despite high prevalence of rotavirus in this region prior to vaccine introduction. This study was conducted to assess the impact of rotavirus vaccine on the epidemiology of rotavirus and other enteric viruses, as well as the changes in the diversity of rotavirus strains among children (≤5 years) with acute gastroenteritis.
View Article and Find Full Text PDFVet Sci
December 2024
Department of Virology, Croatian Veterinary Institute, 10000 Zagreb, Croatia.
Acute gastroenteritis (AGE) in cattle significantly impacts the economy due to relatively high morbidity and mortality and decreased production. Its multifactorial nature drives its global persistence, involving enteric viruses, bacteria, protozoa, and environmental factors. Bovine (BoRVA) and bovine coronavirus (BCoV) are among the most important enteric RNA viruses causing AGE in cattle.
View Article and Find Full Text PDFEmerg Microbes Infect
December 2024
Institute of Virology, University of Veterinary Medicine Hannover, Hannover, Germany.
Rotaviruses, non-enveloped viruses with a double-stranded RNA genome, are the leading etiological pathogen of acute gastroenteritis in young children and animals. The P[11] genotype of rotaviruses exhibits a tropism for neonates. In the present study, a binding assay using synthetic oligosaccharides demonstrated that the VP8* protein of P[11] porcine rotavirus (PRV) strain 4555 binds to lacto-N-neotetraose (LNnT) with the sequence Galβ1,4-GlcNAcβ1,3-Galβ1,4-Glc, one of the core parts of histo-blood group antigen (HBGA) and milk glycans.
View Article and Find Full Text PDFEnter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!