The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K(+)- or NH(4)(+)-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1-P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In K(+) buffer, P1-P4 bind the ckit87up quadruplex structure as "quadruplex-binding agents". The same holds for P1 in NH(4)(+) solution. On the contrary, in NH(4)(+) solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as "quadruplex openers".
Download full-text PDF |
Source |
|---|---|
| http://dx.doi.org/10.1021/bc100444v | DOI Listing |
Publication Analysis
Top Keywords
Similar Publications
The triazatruxene derivative azatrux binds to the parallel form of the human telomeric G-quadruplex under molecular crowding conditions: biophysical and molecular modeling studies.
Biochimie
August 2011
Dipartimento di Chimica P. Corradini, Università di Napoli Federico II, via Cintia 4, Naples, Italy.
Article Synopsis
- The study examines how the compound azatrux binds to a specific human telomeric G-quadruplex using various scientific methods, including spectroscopy and calorimetry, especially under crowded molecular conditions.
- Azatrux binds to the G-quadruplex in an end-stacking fashion, and the research identifies important structural features that aid this binding.
- The compound shows a strong preference for binding to the human telomeric G-quadruplex compared to another G-quadruplex and duplex DNA when crowding is present, indicating its selectivity.
Targeting G-quadruplex structure in the human c-Kit promoter with short PNA sequences.
Bioconjug Chem
April 2011
Dipartimento di Chimica delle Sostanze Naturali, Università degli Studi di Napoli Federico II, via D. Montesano 49, 80131, Napoli, Italy.
The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K(+)- or NH(4)(+)-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies.
View Article and Find Full Text PDFWant AI Summaries of new PubMed Abstracts delivered to your In-box?
Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!