Cystic fibrosis is one of the most common genetically inherited diseases in Northern Europe, consisting of an inherited defect of chloride transport in the epithelium. Of the several mutations related to CF, the ΔF508 mutation occurs in ca. 70% of the cases. In this work the use of a gold nano-particle supported fluorescence molecular beacon was investigated as an optical sensing platform for the detection of the ΔF508 cystic fibrosis associated mutation. Different parameters such as molecular beacon design, Au nano-particle size, molecular beacon-nano-particle conjugation protocol, molecular beacon loading as well as experimental conditions were evaluated. A 31-base long molecular beacon, containing a 15-base recognition sequence specific for the mutant target, was linked via a thiol modified poly thymine linker (10 bases long) to a 13 nm gold nano-particle and was exposed to mutant and wild type targets, and a clear differentiation was achieved at target concentrations as low as 1 nM.
Download full-text PDF |
Source |
|---|---|
| http://dx.doi.org/10.1016/j.bios.2010.08.043 | DOI Listing |
Publication Analysis
Top Keywords
Similar Publications
From signal-off to signal-on: polyT linker alters signal response mode and enhances signal change of aptamer beacon probe.
Anal Bioanal Chem
January 2025
College of Chemistry and Chemical Engineering, Linyi University, Linyi, 276000, China.
A molecular beacon is an oligonucleotide hybridization probe that can report the presence of specific nucleic acids in homogeneous solutions. Using an aptamer has allowed an aptamer-based molecular beacon-aptamer beacon to be developed, which has shown advantages of simplicity, rapidity, and sensitivity in imaging and sensing non-nucleic acid substances. However, due to requirement for a deliberate DNA hairpin structure for the preparation of a molecular beacon, not any given aptamer is suitable for designing an aptamer beacon probe.
View Article and Find Full Text PDFDual-signal fluorescence detection of miRNA based on nano-gold molecular beacon and in-situ generated silver nanoclusters coupled with multiple amplification.
Talanta
December 2024
College of Chemistry and Molecular Engineering. Qingdao University of Science and Technology, Qingdao, 266042, China. Electronic address:
In this work, a new dual-signal fluorescence strategy based on nano-gold molecular beacon (MB) and in-situ generated silver nano-clusters (NCs) coupled with multiple amplification technique was developed for sensitive detection of miRNA (let-7b). miRNA can recognize both hairpin probe (HP) and auxiliary DNA, inducing dual-cycle amplification-process to release plenty of DNA S2. As the report probe carboxyfluorescein (FAM) was modified on Au nanoparticles (AuNPs), the fluorescent signal was quenched due to the fluorescence resonance energy transfer (FRET).
View Article and Find Full Text PDFTargeted LNPs deliver IL-15 superagonists mRNA for precision cancer therapy.
Biomaterials
December 2024
Department of Biomedical Engineering, College of Future Technology, Peking University, Beijing, 100871, China; Beijing Advanced Center of RNA Biology (BEACON), Peking University, Beijing, 100871, China. Electronic address:
Interleukin-15 (IL-15) emerges as a promising immunotherapeutic candidate, but the therapeutic utility remains concern due to the unexpected systematic stress. Here, we propose that the mRNA lipid nanoparticle (mRNA-LNP) system can balance the issue through targeted delivery to increase IL-15 concentration in the tumor area and reduce leakage into the circulation. In the established Structure-driven TARgeting (STAR) platform, the LNP and LNP can effectively and selectively deliver optimized IL-15 superagonists mRNAs to local and lungs, respectively, in relevant tumor models.
View Article and Find Full Text PDFDevelopment of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A.
Mol Biotechnol
December 2024
Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.
The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.
View Article and Find Full Text PDFFinding potential inhibitors from phytochemicals against nucleoprotein of crimean congo fever virus using in silico approach.
Sci Rep
December 2024
Department of Chemical and Biological Engineering, Gachon University, Seongnam, 13120, Republic of Korea.
The Crimean Congo virus has been reported to be a part of the spherical RNA-enveloped viruses from the Bunyaviridae family. Crimean Congo fever (CCHF) is a fatal disease with having fatality rate of up to 40%. It is declared endemic by the World Health Organization.
View Article and Find Full Text PDFWant AI Summaries of new PubMed Abstracts delivered to your In-box?
Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!