Warfarin anticoagulation therapy is complicated by its narrow therapeutic index and by wide inter-individual differences in dosing requirements arising, in part, from genetic factors. The present report describes the development, validation and feasibility testing of a rapid genotyping assay that concurrently detects the CYP2C9*2 and *3 variants along with the VKORC1 C1173T polymorphism. The study employed melting curve analysis using labeled probes and compared two detection instruments (the HR-1 and the R.A.P.I.D. LT) to two previously validated methods, 5' nuclease allelic discrimination (Taqman) assay and cycle sequencing. The HR-1 detected 189 true negatives and 113 true positives; 1 wild-type sample was mistyped as a heterozygote by both instruments. Sequencing of that sample confirmed it to be a CC homozygote; however, a rare C > T polymorphism was discovered 1 base 5' from the *2 polymorphic site, presumably causing the mistaken genotype by melting curve. Both methods had sensitivity = 1.00 and specificity > 0.99. Combined with a method for rapid buccal swab DNA extraction, genotyping results were obtained in a median of 59 min. These methods should facilitate genotype-driven warfarin dosing in "real-time" clinical practice.
Download full-text PDF |
Source |
---|---|
http://dx.doi.org/10.1007/s11239-007-0077-x | DOI Listing |
Acta Parasitol
January 2025
Department of Veterinary Medicine, Federal University of Paraná, Rua Dos Funcionários, 1540, Curitiba, Paraná, 80035-050, Brazil.
Purpose: The aim of the present study was to establish a SYBR Green-based real-time PCR assay for detection of the Nc5 segment from the Neospora caninum genome.
Methods: The oligonucleotides sequences targeting the Nc5 gene previously reported and designed in-house were validated. Two Primer sets were evaluated and tested in four different combinations.
Phys Rev Lett
December 2024
European Synchrotron Radiation Facility (ESRF), 71 Avenue des Martyrs, Grenoble, CS 40220, 38043, France.
Studying the properties and phase diagram of iron at high-pressure and high-temperature conditions has relevant implications for Earth's inner structure and dynamics and the temperature of the inner core boundary (ICB) at 330 GPa. Also, a hexagonal-closed packed to body-centered cubic (bcc) phase transition has been predicted by many theoretical works but observed only in a few experiments. The recent coupling of high-power laser with advanced x-ray sources from synchrotrons allows for novel approaches to address these issues.
View Article and Find Full Text PDFEnviron Sci Pollut Res Int
January 2025
Department of Civil, Geological, and Environmental Engineering, College of Engineering, University of Saskatchewan, 57 Campus Drive, Engineering Building, Saskatoon, SK, S7N 5A9, Canada.
Extending unfrozen water availability is critical for stress-tolerant bioremediation of contaminated soils in cold climates. This study employs the soil-freezing characteristic curves (SFCCs) of biostimulated, hydrocarbon-contaminated cold-climate soils to efficiently address the coupled effects of unfrozen water retention and freezing soil temperature on sub-zero soil respiration activity. Freezing-induced soil respiration experiments were conducted under the site-relevant freezing regime, programmed from 4 to - 10 °C at a seasonal soil-freezing rate of - 1 °C/day.
View Article and Find Full Text PDFInfect Dis Clin Microbiol
December 2024
Department of Infectious Diseases and Clinical Microbiology, İstanbul University-Cerrahpaşa, Cerrahpaşa School of Medicine, İstanbul, Türkiye.
Mol Biotechnol
December 2024
Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.
The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.
View Article and Find Full Text PDFEnter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!