Human cytomegalovirus UL84 interacts with an RNA stem-loop sequence found within the RNA/DNA hybrid region of oriLyt.

J Virol

University of Nevada--Reno, Department of Microbiology, School of Medicine, Howard Bldg., Reno, NV 89557, USA.

Published: July 2007

Human cytomegalovirus (HCMV) lytic DNA replication is initiated at the complex cis-acting oriLyt region, which spans nearly 3 kb. DNA synthesis requires six core proteins together with UL84 and IE2. Previously, two essential regions were identified within oriLyt. Essential region I (nucleotides [nt] 92209 to 92573) can be replaced with the constitutively active simian virus 40 promoter, which in turn eliminates the requirement for IE2 in the origin-dependent transient-replication assay. Essential region II (nt 92979 to 93513) contains two elements of interest: an RNA/DNA hybrid domain and an inverted repeat sequence capable of forming a stem-loop structure. Our studies now reveal for the first time that UL84 interacts with a stem-loop RNA oligonucleotide in vitro, and although UL84 interacted with other nucleic acid substrates, a specific interaction occurred only with the RNA stem-loop. Increasing concentrations of purified UL84 produced a remarkable downward-staircase pattern, which is not due to a nuclease activity but is dependent upon the presence of secondary structures, suggesting that UL84 modifies the conformation of the RNA substrate. Cross-linking experiments show that UL84 possibly changes the conformation of the RNA substrate. The addition of purified IE2 to the in vitro binding reaction did not affect binding to the stem-loop structure. Chromatin immunoprecipitation assays performed using infected cells and purified virus show that UL84 is bound to oriLyt in a region adjacent to the RNA/DNA hybrid and the stem-loop structure. These results solidify UL84 as the potential initiator of HCMV DNA replication through a unique interaction with a conserved RNA stem-loop structure within oriLyt.

Download full-text PDF

Source
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1933308PMC
http://dx.doi.org/10.1128/JVI.00058-07DOI Listing

Publication Analysis

Top Keywords

stem-loop structure
16
rna stem-loop
12
rna/dna hybrid
12
ul84
9
human cytomegalovirus
8
ul84 interacts
8
dna replication
8
orilyt region
8
essential region
8
conformation rna
8

Similar Publications

Development of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A.

Mol Biotechnol

December 2024

Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.

The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.

View Article and Find Full Text PDF

is a gram-negative bacterium that demonstrates a remarkable ability to acquire antibiotic resistance genes (ARGs). The role of the CRISPR-Cas system in influencing antibiotic resistance in is still under investigation. This study explores the distribution and impact of CRISPR-Cas systems on antibiotic resistance by analyzing 316 genomes.

View Article and Find Full Text PDF

The dengue virus (DENV) NS5 protein plays a central role in dengue viral RNA synthesis which makes it an attractive target for antiviral drug development. DENV NS5 is known to interact with the stem-loop A (SLA) promoter at the 5'-untranslated region (5'-UTR) of the viral genome as a molecular recognition signature for the initiation of negative strand synthesis at the 3' end of the viral genome. However, the conformational dynamics involved in these interactions are yet to be fully elucidated.

View Article and Find Full Text PDF

Uridine insertion/deletion editing of mitochondrial messenger RNAs (mRNAs) in kinetoplastids entails the coordinated action of three complexes. RNA Editing Catalytic Complexes (RECCs) catalyze the enzymatic reactions, while the RNA Editing Substrate Binding Complex (RESC) and RNA Editing Helicase 2 Complex (REH2C) coordinate interactions between RECCs, mRNAs and hundreds of guide RNAs that direct edited sequences. Additionally, numerous auxiliary factors are required for productive editing of specific mRNAs.

View Article and Find Full Text PDF

In India, plants from the non-cultivated, horticultural, and agricultural categories are commonly infected with various begomoviruses, most of which produce yellow mosaic, bright yellow mosaic, or curling symptoms on leaves. In this study, the complete genome of a new bipartite begomovirus causing yellow mosaic disease (YMD) in butterfly pea (Clitoria ternatea L.) was characterized using rolling-circle amplification followed by restriction digestion, cloning, and sequencing to obtain the full-length DNA-A (2727 nt) and DNA-B (2648 nt) sequences.

View Article and Find Full Text PDF

Want AI Summaries of new PubMed Abstracts delivered to your In-box?

Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!