We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere.
Download full-text PDF |
Source |
|---|---|
| http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1317595 | PMC |
| http://dx.doi.org/10.1128/JB.188.1.37-44.2006 | DOI Listing |
Publication Analysis
Top Keywords
Similar Publications
A biocompatible β-cyclodextrin inclusion complex containing natural extracts: a promising antibiofilm agent.
Nanoscale Adv
January 2025
Department of Chemistry, School of Sciences & Engineering, The American University in Cairo AUC Avenue, P.O. Box 74 New Cairo 11835 Egypt +202 2615 2559.
Biofilms formed by several bacterial strains still pose a significant challenge to healthcare due to their resistance to conventional treatment approaches, including antibiotics. This study explores the potential of loading natural extracts with antimicrobial activities into β-cyclodextrin (βCD) nanoparticles, which are FDA-approved and have superior biocompatibility owing to their cyclic sugar structures, for biofilm eradication. An inclusion complex of βCD carrying essential oils (BOS) was prepared and characterized with regard to its physicochemical properties, antimicrobial efficacy, and antibiofilm activities.
View Article and Find Full Text PDFPathway Elucidation and Key Enzymatic Processes in the Biodegradation of Difenoconazole by A-3.
J Agric Food Chem
January 2025
Key Laboratory of Sustainable Utilization of Panax Notoginseng Resources of Yunnan Province, Faculty of Life Science and Technology, Kunming University of Science and Technology, Kunming, Yunnan 650500, China.
The extensive agricultural use of the fungicide difenoconazole (DIF) and its associated toxicity increasingly damage ecosystems and human health. Thus, an urgent need is to develop environmentally friendly technological approaches capable of effectively removing DIF residues. In this study, strain A-3 was isolated for the first time which can degrade DIF efficiently.
View Article and Find Full Text PDFTime-Dependent Growth of ZnO Nanowires: Unveiling Antibacterial and Photocatalytic Properties.
Langmuir
January 2025
ESYCOM, CNRS-UMR 9007, Université Gustave Eiffel, F-77454 Marne-la-Vallée, France.
This study investigates the synthesis, characterization, and functional properties of well-aligned zinc oxide (ZnO) nanowires (NWs) obtained by a two-step hydrothermal method. ZnO NWs were grown on silicon substrates precoated with a ZnO seed layer. The growth process was conducted at 90 °C for different durations (2, 3, and 4 h) to examine the time-dependent evolution of the nanowire properties.
View Article and Find Full Text PDFStructure, kinetics, and mechanism of Pseudomonas putida sulfoquinovose dehydrogenase, the first enzyme in the sulfoglycolytic Entner-Doudoroff pathway.
Biochem J
January 2025
School of Chemistry and Bio21 Molecular Science and Biotechnology Institute, University of Melbourne, Parkville, Victoria 3010, Australia.
The sulfosugar sulfoquinovose (SQ) is catabolized through the sulfoglycolytic Entner-Doudoroff pathway, beginning with the oxidation of SQ to sulfogluconolactone by SQ dehydrogenase. We present a comprehensive structural and kinetic characterization of Pseudomonas putida SQ dehydrogenase (PpSQDH). PpSQDH is a tetrameric enzyme belonging to the short-chain dehydrogenase/reductase (SDR) superfamily with a strong preference for NAD+ over NADP+.
View Article and Find Full Text PDFEngineering probiotic Escherichia coli for inflammation-responsive indoleacetic acid production using RiboJ-enhanced genetic circuits.
J Biol Eng
January 2025
Synthetic Biology Research Center and the K-Biofoundry, Korea Research Institute of Bioscience and Biotechnology (KRIBB), Daejeon, 34141, Republic of Korea.
Background: As our understanding of gut microbiota's metabolic impacts on health grows, the interest in engineered probiotics has intensified. This study aimed to engineer the probiotic Escherichia coli Nissle 1917 (EcN) to produce indoleacetic acid (IAA) in response to gut inflammatory biomarkers thiosulfate and nitrate.
Results: Genetic circuits were developed to initiate IAA synthesis upon detecting inflammatory signals, optimizing a heterologous IAA biosynthetic pathway, and incorporating a RiboJ insulator to enhance IAA production.
Want AI Summaries of new PubMed Abstracts delivered to your In-box?
Enter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!