In an attempt to determine the cultural factors that would improve cloning efficiency, we compared the effects of two incubation systems-a simple portable system and a standard CO2 incubator-on the production of bovine embryos by electrofusion of quiescent fetal fibroblast nuclei to enucleated oocytes matured in vitro. While the temperature (38.5 degrees C) and CO2 concentration (5%) were similar in both systems, the portable incubator operated in a vacuum of 300 mmHg and at an O2 level of 8-10%, which is lower than the standard. Although there were no significant differences between the two systems in terms of in vitro oocyte maturation (MII stage), fusion rates, and the number of cells in Day 7 blastocysts, significantly higher proportions of nuclear-transferred oocytes cleaved (P < 0.05) and developed to the blastocyst stage (P < 0.01) in the portable incubator (70.5 +/- 0.6 and 36.1 +/- 1.4%, respectively) than in the standard incubator (64.1 +/- 3.2 and 23.5 +/- 1.4%, respectively). Following the transfer of six blastocysts from the portable incubator group to three recipients, survival rates on Days 60, 90, and 120 were 100, 66.7 and 33.3%, respectively. This relatively high early embryonic loss may be associated with multiple pregnancy complications or other abnormalities of placentation frequently observed in cloned embryos. Further studies using this portable incubator system are needed to determine the optimum levels of O2, CO2, and air pressure.
Download full-text PDF |
Source |
---|---|
http://dx.doi.org/10.1016/s0093-691x(02)00909-3 | DOI Listing |
Chem Commun (Camb)
January 2025
State Key Laboratory of Environment Health (Incubation), Key Laboratory of Environment and Health, Ministry of Education, Key Laboratory of Environment and Health (Wuhan), Ministry of Environmental Protection, School of Public Health, Tongji Medical College, Huazhong University of Science and Technology, Hangkong Road #13, Wuhan, Hubei 430030, China.
The monitoring of antibiotic resistance genes (ARGs) is crucial for understanding the level of antimicrobial resistance and the associated health burden, which in turn is essential for the control and prevention of antimicrobial resistance (AMR). Isothermal amplification, an emerging molecular biology technology, has been widely used for drug resistance detection. Furthermore, its compatibility with a range of technologies enables high-specificity, high-throughput, and portable and integrated detection in drug resistance, particularly in resource-limited areas.
View Article and Find Full Text PDFMol Biotechnol
December 2024
Department of Biosciences and Bioengineering, Indian Institute of Technology Guwahati, Guwahati, Assam, 781039, India.
The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target.
View Article and Find Full Text PDFBiosensors (Basel)
December 2024
CEA, INRAE, Département Médicaments et Technologies pour la Santé (DMTS), Université Paris-Saclay, SPI, 91191 Gif-sur-Yvette, France.
Diagnostics often require specialized equipment and trained personnel in laboratory settings, creating a growing need for point-of-care tests (POCTs). Among the genetic testing methods available, Loop-mediated Isothermal Amplification (LAMP) offers a viable solution for developing genetic POCT due to its compatibility with simplified devices. This study aimed to create a genetic test that integrates all steps from sample processing to analyzing results while minimizing the complexity, handling, equipment, and time required.
View Article and Find Full Text PDFSci Total Environ
December 2024
Institute of Experimental Medicine of the Czech Academy of Sciences, Videnska 1084, Prague 4, Czech Republic.
Exposure of cell cultures at air-liquid interface (ALI), mimicking i.e. human lung surface, is believed to be one of the most realistic means to model toxicity of complex mixtures of pollutants on human health.
View Article and Find Full Text PDFHardwareX
December 2024
Laboratory of Biosensors and Bioelectronics, Institute for Biomedical Engineering, Eidgenössische Technische Hochschule (ETH) Zürich, Switzerland.
Culturing living cells requires the maintenance of physiological conditions for extended periods of time. Here, we introduce a versatile and affordable incubation system, addressing the limitations of traditional incubation systems. Conventionally, stationary cell incubators maintain constant temperature and gas levels for cell culturing.
View Article and Find Full Text PDFEnter search terms and have AI summaries delivered each week - change queries or unsubscribe any time!