A community effort in SARS-CoV-2 drug discovery.

The COVID-19 pandemic continues to pose a substantial threat to human lives and is likely to do so for years to come. Despite the availability of vaccines, searching for efficient small-molecule drugs that are widely available, including in low- and middle-income countries, is an ongoing challenge. In this work, we report the results of an open science community effort, the "Billion molecules against COVID-19 challenge", to identify small-molecule inhibitors against SARS-CoV-2 or relevant human receptors.

Chemical Modulation of DNA Replication along G-Quadruplex Based on Topology-Dependent Ligand Binding.

Ligands that bind to and stabilize guanine-quadruplex (G4) structures to regulate DNA replication have therapeutic potential for cancer and neurodegenerative diseases. Because there are several G4 topologies, ligands that bind to their specific types may have the ability to preferentially regulate the replication of only certain genes. Here, we demonstrated that binding ligands stalled the replication of template DNA at G4, depending on different topologies.

A biphenyl inhibitor of eIF4E targeting an internal binding site enables the design of cell-permeable PROTAC-degraders.

The eukaryotic translation initiation factor 4E (eIF4E) is the master regulator of cap-dependent protein synthesis. Overexpression of eIF4E is implicated in diseases such as cancer, where dysregulation of oncogenic protein translation is frequently observed. eIF4E has been an attractive target for cancer treatment.

Cryo-EM structure of an activated GPCR-G protein complex in lipid nanodiscs.

G-protein-coupled receptors (GPCRs) are the largest superfamily of transmembrane proteins and the targets of over 30% of currently marketed pharmaceuticals. Although several structures have been solved for GPCR-G protein complexes, few are in a lipid membrane environment. Here, we report cryo-EM structures of complexes of neurotensin, neurotensin receptor 1 and Gαβγ in two conformational states, resolved to resolutions of 4.

A Multi-Pronged Approach Targeting SARS-CoV-2 Proteins Using Ultra-Large Virtual Screening.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), previously known as 2019 novel coronavirus (2019-nCoV), has spread rapidly across the globe, creating an unparalleled global health burden and spurring a deepening economic crisis. As of July 7th, 2020, almost seven months into the outbreak, there are no approved vaccines and few treatments available. Developing drugs that target multiple points in the viral life cycle could serve as a strategy to tackle the current as well as future coronavirus pandemics.

An open-source drug discovery platform enables ultra-large virtual screens.

On average, an approved drug currently costs US$2-3 billion and takes more than 10 years to develop. In part, this is due to expensive and time-consuming wet-laboratory experiments, poor initial hit compounds and the high attrition rates in the (pre-)clinical phases. Structure-based virtual screening has the potential to mitigate these problems.

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure.

A Massively Parallel Selection of Small Molecule-RNA Motif Binding Partners Informs Design of an Antiviral from Sequence.

Many RNAs cause disease; however, RNA is rarely exploited as a small-molecule drug target. Our programmatic focus is to define privileged RNA motif small-molecule interactions to enable the rational design of compounds that modulate RNA biology starting from only sequence. We completed a massive, library-versus-library screen that probed over 50 million binding events between RNA motifs and small molecules.

The Hairpin Form of r(GC) in c9ALS/FTD Is Repeat-Associated Non-ATG Translated and a Target for Bioactive Small Molecules.

The most common genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) is an expanded GC repeat [(GC)] in C9ORF72. ALS/FTD-associated toxicity has been traced to the RNA transcribed from the repeat expansion [r(GC)], which sequesters RNA-binding proteins (RBPs) and undergoes repeat-associated non-ATG (RAN) translation to generate toxic dipeptide repeats. Using in vitro and cell-based assays, we identified a small molecule (4) that selectively bound r(GC), prevented sequestration of an RBP, and inhibited RAN translation.

Approved Anti-cancer Drugs Target Oncogenic Non-coding RNAs.

Potential RNA drug targets for small molecules are found throughout the human transcriptome, yet small molecules known to elicit a pharmacological response by directly targeting RNA are limited to antibacterials. Herein, we describe AbsorbArray, a small molecule microarray-based approach that allows for unmodified compounds, including FDA-approved drugs, to be probed for binding to RNA motif libraries in a massively parallel format. Several drug classes bind RNA including kinase and topoisomerase inhibitors.

A G-Quadruplex Structure in the Promoter Region of Functions as a Regulatory Element for Gene Expression.

The differential transcriptional expression of between tumor cells and the surrounding stroma during cancer progression has been suggested to have a tumor-promoting effect. However, little is known about the transcriptional regulation of . To better understand how this gene is regulated, the promoter region of was analyzed.

Using Genome Sequence to Enable the Design of Medicines and Chemical Probes.

Rapid progress in genome sequencing technology has put us firmly into a postgenomic era. A key challenge in biomedical research is harnessing genome sequence to fulfill the promise of personalized medicine. This Review describes how genome sequencing has enabled the identification of disease-causing biomolecules and how these data have been converted into chemical probes of function, preclinical lead modalities, and ultimately U.

Expression of the human telomerase reverse transcriptase gene is modulated by quadruplex formation in its first exon due to DNA methylation.

DNA secondary structures and methylation are two well-known mechanisms that regulate gene expression. The catalytic subunit of telomerase, human telomerase reverse transcriptase (), is overexpressed in ∼90% of human cancers to maintain telomere length for cell immortalization. Binding of CCCTC-binding factor (CTCF) to the first exon of the gene can down-regulate its expression.

A novel transition pathway of ligand-induced topological conversion from hybrid forms to parallel forms of human telomeric G-quadruplexes.

The folding topology of DNA G-quadruplexes (G4s) depends not only on their nucleotide sequences but also on environmental factors and/or ligand binding. Here, a G4 ligand, 3,6-bis(1-methyl-4-vinylpyridium iodide)-9-(1-(1-methyl-piperidinium iodide)-3,6,9-trioxaundecane) carbazole (BMVC-8C3O), can induce topological conversion of non-parallel to parallel forms in human telomeric DNA G4s. Nuclear magnetic resonance (NMR) spectroscopy with hydrogen-deuterium exchange (HDX) reveals the presence of persistent imino proton signals corresponding to the central G-quartet during topological conversion of Tel23 and Tel25 G4s from hybrid to parallel forms, implying that the transition pathway mainly involves local rearrangements.

Direct evidence of mitochondrial G-quadruplex DNA by using fluorescent anti-cancer agents.

G-quadruplex (G4) is a promising target for anti-cancer treatment. In this paper, we provide the first evidence supporting the presence of G4 in the mitochondrial DNA (mtDNA) of live cells. The molecular engineering of a fluorescent G4 ligand, 3,6-bis(1-methyl-4-vinylpyridinium) carbazole diiodide (BMVC), can change its major cellular localization from the nucleus to the mitochondria in cancer cells, while remaining primarily in the cytoplasm of normal cells.

Conformational transition of a hairpin structure to G-quadruplex within the WNT1 gene promoter.

The role of G-quadruplexes (G4s) in biological systems has been widely studied. It is found that they have an important function in gene transcription and regulation. In this work, we have identified two topologies of hairpin and G4 structures formed by a native G-rich sequence (WT22: 5'-GGGCCACCGGGCAGGGGGCGGG-3') from the WNT1 promoter region using nuclear magnetic resonance (NMR) spectroscopy.

The regulatory role of activating transcription factor 2 in inflammation.

Activating transcription factor 2 (ATF2) is a member of the leucine zipper family of DNA-binding proteins and is widely distributed in tissues including the liver, lung, spleen, and kidney. Like c-Jun and c-Fos, ATF2 responds to stress-related stimuli and may thereby influence cell proliferation, inflammation, apoptosis, oncogenesis, neurological development and function, and skeletal remodeling. Recent studies clarify the regulatory role of ATF2 in inflammation and describe potential inhibitors of this protein.

Inhibition of cancer cell migration and invasion through suppressing the Wnt1-mediating signal pathway by G-quadruplex structure stabilizers.

WNT1 encodes a multifunctional signaling glycoprotein that is highly expressed in several malignant tumors. Patients with Wnt1-positive cancer are usually related to advanced metastasis. Here, we found that a stretch of G-rich sequences located at the WNT1 promoter region is capable of forming G-quadruplex structures.

Structural basis of sodium-potassium exchange of a human telomeric DNA quadruplex without topological conversion.

Understanding the mechanism of Na(+)/K(+)-dependent spectral conversion of human telomeric G-quadruplex (G4) sequences has been limited not only because of the structural polymorphism but also the lack of sufficient structural information at different stages along the conversion process for one given oligonucleotide. In this work, we have determined the topology of the Na(+) form of Tel23 G4, which is the same hybrid form as the K(+) form of Tel23 G4 despite the distinct spectral patterns in their respective nuclear magnetic resonance (NMR) and circular dichroism spectra. The spectral difference, particularly the well-resolved imino proton NMR signals, allows us to monitor the structural conversion from Na(+) form to K(+) form during Na(+)/K(+) exchange.

Unfolding kinetics of human telomeric G-quadruplexes studied by NMR spectroscopy.

Characterization of the unfolding kinetics of G-quadruplexes (G4s) is the key to a better understanding of the biological function of G4s and is important for biomedical research and material design. Of interest is that slight variations of human telomeric sequences can form different types of G4 structures. In general, there is a correlation between unfolding kinetics and thermal stability.

In-cell optical imaging of exogenous G-quadruplex DNA by fluorogenic ligands.

Guanine-rich oligonucleotides (GROs) are promising therapeutic candidate for cancer treatment and other biomedical application. We have introduced a G-quadruplex (G4) ligand, 3,6-bis(1-methyl-4-vinylpyridinium) carbazole diiodide, to monitor the cellular uptake of naked GROs and map their intracellular localizations in living cells by using confocal microscopy. The GROs that form parallel G4 structures, such as PU22, T40214 and AS1411, are detected mainly in the lysosome of CL1-0 lung cancer cells after incubation for 2 h.

Chemical principles for the design of a novel fluorescent probe with high cancer-targeting selectivity and sensitivity.

Understanding of principles governing selective and sensitive cancer targeting is critical for development of chemicals for cancer diagnostics and treatment. We determined the underlying mechanisms of how a novel fluorescent small organic molecule, 3,6-bis(1-methyl-4-vinylpyridinium)carbazole diiodide (BMVC), selectively labels cancer cells but not normal cells. We show that BMVC is retained in the lysosomes of normal cells.