Effects of Yellow Sea Warm Current on zooplankton community composition and functional groups in winter.

The Yellow Sea Warm Current (YSWC) constitutes a significant hydrological feature in the Yellow Sea, particularly prominent during winter, facilitating the transport of warm, saline waters and warm-water species from the open sea to the Bohai and Yellow Seas. The YSWC induces alterations in the community structure and function of zooplankton. However, the effects of the YSWC on the functional trait compositions and functional groups of zooplankton remain unclear.

Atmospheric deposition and river runoff stimulate the utilization of dissolved organic phosphorus in coastal seas.

In coastal seas, the role of atmospheric deposition and river runoff in dissolved organic phosphorus (DOP) utilization is not well understood. Here, we address this knowledge gap by combining microcosm experiments with a global approach considering the relationship between the activity of alkaline phosphatases and changes in phytoplankton biomass in relation to the concentration of dissolved inorganic phosphorus (DIP). Our results suggest that the addition of aerosols and riverine water stimulate the biological utilization of DOP in coastal seas primarily by depleting DIP due to increasing nitrogen concentrations, which enhances phytoplankton growth.

Trait-based approach revealed the seasonal variation of mesozooplankton functional groups in the South Yellow Sea.

Unlabelled: Functional traits determine the fitness of organisms and mirror their ecological functions. Although trait-based approaches provide ecological insights, it is underexploited for marine zooplankton, particularly with respect to seasonal variation. Here, based on four major functional traits, including body length, feeding type, trophic group, and reproduction mode, we quantified the seasonal variations of mesozooplankton functional groups in the South Yellow Sea (SYS) in the spring, summer, and autumn of 2018.

Latitudinal transition of epipelagic mesozooplankton in the northwestern Pacific in winter.

The northwestern Pacific (NWP) is a hotspot of marine biodiversity study, and zooplankton is a crucial secondary producer in the marine ecosystem. It is of utmost importance to do extensive study on the distribution of zooplankton community in the NWP. The distribution of epipelagic zooplankton community in the 143-146°E section between the equator and 36°N in winter was examined in this study.

Reduced Fitness and Elevated Oxidative Stress in the Marine Copepod Exposed to the Toxic Dinoflagellate .

Blooms of the toxic dinoflagellate Karenia mikimotoi cause devastation to marine life, including declines of fitness and population recruitment. However, little is known about the effects of them on benthic copepods. Here, we assessed the acute and chronic effects of K.

Eukaryotic plankton community assembly and influencing factors between continental shelf and slope sites in the northern South China Sea.

Eukaryotic plankton are pivotal members of marine ecosystems playing crucial roles in marine food webs and biogeochemical cycles. However, understanding the patterns and drivers of their community assembly remains a grand challenge. A study was conducted in the northern South China Sea (SCS) to address this issue.

Effects of Prorocentrum donghaiense bloom on zooplankton functional groups in the coastal waters of the East China Sea.

Blooms of the non-toxic dinoflagellate Prorocentrum donghaiense are common in the East China Sea; however, the in situ impacts of these blooms on zooplankton community functions have not yet been conducted in this area. Using functional trait-based methods, we found that P. donghaiense bloom significantly changed the zooplankton community structure and functions in the coastal water of the East China Sea.

Diversity, prevalence, and expression of cyanase genes (cynS) in planktonic marine microorganisms.

Cyanate is utilized by many microbes as an organic nitrogen source. The key enzyme for cyanate metabolism is cyanase, converting cyanate to ammonium and carbon dioxide. Although the cyanase gene cynS has been identified in many species, the diversity, prevalence, and expression of cynS in marine microbial communities remains poorly understood.

Spatial distribution and source of biotoxins in phytoplankton from the South China Sea, China.

Marine phycotoxins severely threaten ecosystem health and mariculture. This study investigates the spatial distribution and source of diverse phycotoxins in the South China Sea (SCS), during four 2019/2020 cruises. Saxitoxin (STX) and okadaic acid (OA) -groups, azaspiracids, cyclic imines, pectenotoxins (PTX), yessotoxins, and domoic acid (DA) toxins were analyzed in microalgal samples.

Insights into the red algae and eukaryotic evolution from the genome of (Bangiophyceae, Rhodophyta).

(laver) belongs to an ancient group of red algae (Bangiophyceae), is harvested for human food, and thrives in the harsh conditions of the upper intertidal zone. Here we present the 87.7-Mbp haploid genome (65.

Spliced leader-based analyses reveal the effects of polycyclic aromatic hydrocarbons on gene expression in the copepod Pseudodiaptomus poplesia.

Polycyclic aromatic hydrocarbons (PAHs) are a group of toxic and carcinogenic pollutants that can adversely affect the development, growth and reproduction of marine organisms including copepods. However, knowledge on the molecular mechanisms regulating the response to PAH exposure in marine planktonic copepods is limited. In this study, we investigated the survival and gene expression of the calanoid copepod Pseudodiaptomus poplesia upon exposure to two PAHs, 1, 2-dimethylnaphthalene (1, 2-NAPH) and pyrene.

Spliced leader RNA trans-splicing discovered in copepods.

Copepods are one of the most abundant metazoans in the marine ecosystem, constituting a critical link in aquatic food webs and contributing significantly to the global carbon budget, yet molecular mechanisms of their gene expression are not well understood. Here we report the detection of spliced leader (SL) trans-splicing in calanoid copepods. We have examined nine species of wild-caught copepods from Jiaozhou Bay, China that represent the major families of the calanoids.

The Symbiodinium kawagutii genome illuminates dinoflagellate gene expression and coral symbiosis.

Dinoflagellates are important components of marine ecosystems and essential coral symbionts, yet little is known about their genomes. We report here on the analysis of a high-quality assembly from the 1180-megabase genome of Symbiodinium kawagutii. We annotated protein-coding genes and identified Symbiodinium-specific gene families.

DNA barcoding species in Alexandrium tamarense complex using ITS and proposing designation of five species.

Alexandrium species can be very difficult to identify, with A. catenella, A. tamarense, and A.

Proof that dinoflagellate spliced leader (DinoSL) is a useful hook for fishing dinoflagellate transcripts from mixed microbial samples: Symbiodinium kawagutii as a case study.

The ability to analyze dinoflagellate lineage-specific transcriptomes in the natural environment would be powerful for gaining understanding on how these organisms thrive in diverse environments and how they form harmful algal blooms and produce biotoxins. This can be made possible by lineage-specific mRNA markers such as the dinoflagellate-specific trans-spliced leader (DinoSL). By constructing and sequencing a 5'-cap selective full-length cDNA library for a monoculture of the coral reef endosymbiotic dinoflagellate Symbiodinium kawagutii and a DinoSL-based cDNA library for a mixture of S.

Polyadenylation of 18S rRNA in algae(1).

Polyadenylation is best known for occurring to mRNA of eukaryotes transcribed by RNA polymerase II to stabilize mRNA molecules and promote their translation. rRNAs transcribed by RNA polymerase I or III are typically believed not to be polyadenylated. However, there is increasing evidence that polyadenylation occurs to nucleus-encoded rRNAs as part of the RNA degradation pathway.

Transcriptomic study reveals widespread spliced leader trans-splicing, short 5'-UTRs and potential complex carbon fixation mechanisms in the euglenoid Alga Eutreptiella sp.

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing.

Porphyra (Bangiophyceae) Transcriptomes Provide Insights Into Red Algal Development And Metabolism.

The red seaweed Porphyra (Bangiophyceae) and related Bangiales have global economic importance. Here, we report the analysis of a comprehensive transcriptome comprising ca. 4.

MAJOR DEVELOPMENTAL REGULATORS AND THEIR EXPRESSION IN TWO CLOSELY RELATED SPECIES OF PORPHYRA (RHODOPHYTA)(1).

Little is known about the genetic and biochemical mechanisms that underlie red algal development, for example, why the group failed to evolve complex parenchyma and tissue differentiation. Here we examined expressed sequence tag (EST) data from two closely related species, Porphyra umbilicalis (L.) J.

Analysis of Porphyra membrane transporters demonstrates gene transfer among photosynthetic eukaryotes and numerous sodium-coupled transport systems.

Membrane transporters play a central role in many cellular processes that rely on the movement of ions and organic molecules between the environment and the cell, and between cellular compartments. Transporters have been well characterized in plants and green algae, but little is known about transporters or their evolutionary histories in the red algae. Here we examined 482 expressed sequence tag contigs that encode putative membrane transporters in the economically important red seaweed Porphyra (Bangiophyceae, Rhodophyta).

Spliced leader-based metatranscriptomic analyses lead to recognition of hidden genomic features in dinoflagellates.

Environmental transcriptomics (metatranscriptomics) for a specific lineage of eukaryotic microbes (e.g., Dinoflagellata) would be instrumental for unraveling the genetic mechanisms by which these microbes respond to the natural environment, but it has not been exploited because of technical difficulties.

High-level diversity of dinoflagellates in the natural environment, revealed by assessment of mitochondrial cox1 and cob genes for dinoflagellate DNA barcoding.

DNA barcoding is a diagnostic technique for species identification using a short, standardized DNA. An effective DNA barcoding marker would be very helpful for unraveling the poorly understood species diversity of dinoflagellates in the natural environment. In this study, the potential utility for DNA barcoding of mitochondrial cytochrome c oxidase 1 (cox1) and cytochrome b (cob) was assessed.

Characterization and tissue-specific expression of phosphatidylcholine transfer protein gene from amphioxus Branchiostoma belcheri.

An amphioxus cDNA, encoding phosphatidylcholine transfer protein (AmphiPCTP), was identified for the first time from the gut cDNA library of Branchiostoma belcheri. It contains a 660-bp open reading frame corresponding to a deduced protein of 219 amino acids. Phylogenetic tree analysis showed that AmphiPCTP clustered with PCTP subgroup of PCTP subfamily containing steroidogenic acute regulatory protein (StAR)-related lipid transfer (START) domains.