The Yellow Sea Warm Current (YSWC) constitutes a significant hydrological feature in the Yellow Sea, particularly prominent during winter, facilitating the transport of warm, saline waters and warm-water species from the open sea to the Bohai and Yellow Seas. The YSWC induces alterations in the community structure and function of zooplankton. However, the effects of the YSWC on the functional trait compositions and functional groups of zooplankton remain unclear.
View Article and Find Full Text PDFIn coastal seas, the role of atmospheric deposition and river runoff in dissolved organic phosphorus (DOP) utilization is not well understood. Here, we address this knowledge gap by combining microcosm experiments with a global approach considering the relationship between the activity of alkaline phosphatases and changes in phytoplankton biomass in relation to the concentration of dissolved inorganic phosphorus (DIP). Our results suggest that the addition of aerosols and riverine water stimulate the biological utilization of DOP in coastal seas primarily by depleting DIP due to increasing nitrogen concentrations, which enhances phytoplankton growth.
View Article and Find Full Text PDFUnlabelled: Functional traits determine the fitness of organisms and mirror their ecological functions. Although trait-based approaches provide ecological insights, it is underexploited for marine zooplankton, particularly with respect to seasonal variation. Here, based on four major functional traits, including body length, feeding type, trophic group, and reproduction mode, we quantified the seasonal variations of mesozooplankton functional groups in the South Yellow Sea (SYS) in the spring, summer, and autumn of 2018.
View Article and Find Full Text PDFThe northwestern Pacific (NWP) is a hotspot of marine biodiversity study, and zooplankton is a crucial secondary producer in the marine ecosystem. It is of utmost importance to do extensive study on the distribution of zooplankton community in the NWP. The distribution of epipelagic zooplankton community in the 143-146°E section between the equator and 36°N in winter was examined in this study.
View Article and Find Full Text PDFBlooms of the toxic dinoflagellate Karenia mikimotoi cause devastation to marine life, including declines of fitness and population recruitment. However, little is known about the effects of them on benthic copepods. Here, we assessed the acute and chronic effects of K.
View Article and Find Full Text PDFEukaryotic plankton are pivotal members of marine ecosystems playing crucial roles in marine food webs and biogeochemical cycles. However, understanding the patterns and drivers of their community assembly remains a grand challenge. A study was conducted in the northern South China Sea (SCS) to address this issue.
View Article and Find Full Text PDFBlooms of the non-toxic dinoflagellate Prorocentrum donghaiense are common in the East China Sea; however, the in situ impacts of these blooms on zooplankton community functions have not yet been conducted in this area. Using functional trait-based methods, we found that P. donghaiense bloom significantly changed the zooplankton community structure and functions in the coastal water of the East China Sea.
View Article and Find Full Text PDFCyanate is utilized by many microbes as an organic nitrogen source. The key enzyme for cyanate metabolism is cyanase, converting cyanate to ammonium and carbon dioxide. Although the cyanase gene cynS has been identified in many species, the diversity, prevalence, and expression of cynS in marine microbial communities remains poorly understood.
View Article and Find Full Text PDFMarine phycotoxins severely threaten ecosystem health and mariculture. This study investigates the spatial distribution and source of diverse phycotoxins in the South China Sea (SCS), during four 2019/2020 cruises. Saxitoxin (STX) and okadaic acid (OA) -groups, azaspiracids, cyclic imines, pectenotoxins (PTX), yessotoxins, and domoic acid (DA) toxins were analyzed in microalgal samples.
View Article and Find Full Text PDF(laver) belongs to an ancient group of red algae (Bangiophyceae), is harvested for human food, and thrives in the harsh conditions of the upper intertidal zone. Here we present the 87.7-Mbp haploid genome (65.
View Article and Find Full Text PDFPolycyclic aromatic hydrocarbons (PAHs) are a group of toxic and carcinogenic pollutants that can adversely affect the development, growth and reproduction of marine organisms including copepods. However, knowledge on the molecular mechanisms regulating the response to PAH exposure in marine planktonic copepods is limited. In this study, we investigated the survival and gene expression of the calanoid copepod Pseudodiaptomus poplesia upon exposure to two PAHs, 1, 2-dimethylnaphthalene (1, 2-NAPH) and pyrene.
View Article and Find Full Text PDFCopepods are one of the most abundant metazoans in the marine ecosystem, constituting a critical link in aquatic food webs and contributing significantly to the global carbon budget, yet molecular mechanisms of their gene expression are not well understood. Here we report the detection of spliced leader (SL) trans-splicing in calanoid copepods. We have examined nine species of wild-caught copepods from Jiaozhou Bay, China that represent the major families of the calanoids.
View Article and Find Full Text PDFDinoflagellates are important components of marine ecosystems and essential coral symbionts, yet little is known about their genomes. We report here on the analysis of a high-quality assembly from the 1180-megabase genome of Symbiodinium kawagutii. We annotated protein-coding genes and identified Symbiodinium-specific gene families.
View Article and Find Full Text PDFAlexandrium species can be very difficult to identify, with A. catenella, A. tamarense, and A.
View Article and Find Full Text PDFThe ability to analyze dinoflagellate lineage-specific transcriptomes in the natural environment would be powerful for gaining understanding on how these organisms thrive in diverse environments and how they form harmful algal blooms and produce biotoxins. This can be made possible by lineage-specific mRNA markers such as the dinoflagellate-specific trans-spliced leader (DinoSL). By constructing and sequencing a 5'-cap selective full-length cDNA library for a monoculture of the coral reef endosymbiotic dinoflagellate Symbiodinium kawagutii and a DinoSL-based cDNA library for a mixture of S.
View Article and Find Full Text PDFPolyadenylation is best known for occurring to mRNA of eukaryotes transcribed by RNA polymerase II to stabilize mRNA molecules and promote their translation. rRNAs transcribed by RNA polymerase I or III are typically believed not to be polyadenylated. However, there is increasing evidence that polyadenylation occurs to nucleus-encoded rRNAs as part of the RNA degradation pathway.
View Article and Find Full Text PDFEutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing.
View Article and Find Full Text PDFThe red seaweed Porphyra (Bangiophyceae) and related Bangiales have global economic importance. Here, we report the analysis of a comprehensive transcriptome comprising ca. 4.
View Article and Find Full Text PDFLittle is known about the genetic and biochemical mechanisms that underlie red algal development, for example, why the group failed to evolve complex parenchyma and tissue differentiation. Here we examined expressed sequence tag (EST) data from two closely related species, Porphyra umbilicalis (L.) J.
View Article and Find Full Text PDFMembrane transporters play a central role in many cellular processes that rely on the movement of ions and organic molecules between the environment and the cell, and between cellular compartments. Transporters have been well characterized in plants and green algae, but little is known about transporters or their evolutionary histories in the red algae. Here we examined 482 expressed sequence tag contigs that encode putative membrane transporters in the economically important red seaweed Porphyra (Bangiophyceae, Rhodophyta).
View Article and Find Full Text PDFProc Natl Acad Sci U S A
November 2010
Environmental transcriptomics (metatranscriptomics) for a specific lineage of eukaryotic microbes (e.g., Dinoflagellata) would be instrumental for unraveling the genetic mechanisms by which these microbes respond to the natural environment, but it has not been exploited because of technical difficulties.
View Article and Find Full Text PDFDNA barcoding is a diagnostic technique for species identification using a short, standardized DNA. An effective DNA barcoding marker would be very helpful for unraveling the poorly understood species diversity of dinoflagellates in the natural environment. In this study, the potential utility for DNA barcoding of mitochondrial cytochrome c oxidase 1 (cox1) and cytochrome b (cob) was assessed.
View Article and Find Full Text PDFAn amphioxus cDNA, encoding phosphatidylcholine transfer protein (AmphiPCTP), was identified for the first time from the gut cDNA library of Branchiostoma belcheri. It contains a 660-bp open reading frame corresponding to a deduced protein of 219 amino acids. Phylogenetic tree analysis showed that AmphiPCTP clustered with PCTP subgroup of PCTP subfamily containing steroidogenic acute regulatory protein (StAR)-related lipid transfer (START) domains.
View Article and Find Full Text PDF