Peanut Hull lignin/ecamsule·2Na hollow nanoparticles (P/E LNPs): A natural light-coloured, broad-spectrum, highly antioxidant, and safe lignin-based sunscreen.

Lignin represents a potentially significant natural sunscreen alternative due to its good UV-absorbing ability, but its poor UVA absorption and dark colour are still obstacles. Numerous methods have been developed to whiten the colour of lignin, mainly including aromatic ring interruption and hydroxyl group blocking. However, these complicated procedures would weaken the UV-blocking and radical scavenging abilities.

Effect of dexmedetomidine infusion on postoperative sleep disturbances in women with breast cancer: A monocentric randomized-controlled double-blind trial.

Background: Most women with breast cancer are prone to postoperative sleep disturbances (POSD). Little is known about the differences between sevoflurane and propofol combined with dexmedetomidine on POSD in the same context. We investigated the effect of intra-operative sevoflurane or propofol combined with intravenous dexmedetomidine on the incidence of POSD and postoperative sleep structures.

Effects of Baking and Frying on the Protein Oxidation of Wheat Dough.

Protein oxidation caused by food processing is harmful to human health. A large number of studies have focused on the effects of hot processing on protein oxidation of meat products. As an important protein source for human beings, the effects of hot processing on protein oxidation in flour products are also worthy of further study.

FeO-lignin@Pd-NPs: A highly active, stable and broad-spectrum nanocomposite for water treatment.

In this work, we report an environmentally friendly renewable nanocomposite magnetic lignin-based palladium nanoparticles (FeO-lignin@Pd-NPs) for efficient wastewater treatment by decorating palladium nanoparticles without using any toxic reducing agents on the magnetic lignin abstracted from Poplar. The structure of composite FeO-lignin@Pd-NPs was unambiguously confirmed by XRD, SEM, TEM, EDS, FTIR, and Zeta potential. After systematic evaluation of the use and efficiency of the composite to remove toxic organic dyes in wastewater, some promising results were observed as follows: FeO-lignin@Pd-NPs exhibits highly active and efficient performance in the removal of toxic methylene blue (MB) (up to 99.

G-Quadruplexes Formation by the Nucleotide Repeat Expansion d(GGGGCC) and Conformation Regulation by Fangchinoline.

The G-quadruplex (GQ)-forming hexanucleotide repeat expansion (HRE) in the (C9) gene has been found to be the most common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) (collectively, C9ALS/FTD), implying the great significance of modulating C9-HRE GQ structures in C9ALS/FTD therapeutic treatment strategies. In this study, we investigated the GQ structures formed by varied lengths of C9-HRE DNA sequences d(GGGGCC) (C9-24mer) and d(GGGGCC) (C9-48mer), and found that the C9-24mer forms anti-parallel GQ (AP-GQ) in the presence of potassium ions, while the long C9-48mer bearing eight guanine tracts forms unstacked tandem GQ consisting of two C9-24mer unimolecular AP-GQs. Moreover, the natural small molecule Fangchinoline was screened out in order to be able to stabilize and alter the C9-HRE DNA to parallel GQ topology.

Effect of Different Doses of Butorphanol on Postoperative Shivering in Elderly Patients: A Randomized, Double-Blind, Placebo-Controlled Trial.

Purpose: This study was designed to investigate the effects of different doses of butorphanol on postoperative shivering and quality of recovery in elderly patients.

Patients And Methods: A total of 147 elderly patients (aged 60 or older) scheduled for elective transurethral resection of the prostate were enrolled in the current study. Patients were randomly and evenly assigned into four groups: Group C (0.

Unexpected Cascade Dehydrogenation Triggered by Pd/Cu-Catalyzed C(sp)-H Arylation/Intramolecular C-N Coupling of Amides: Facile Access to 1,2-Dihydroquinolines.

In this work, we successfully explored an unexpected dehydrogenation triggered by Pd/Cu-catalyzed C(sp)-H arylation and intramolecular C-N coupling of amides to synthesize the bioactive 1,2-dihydroquinoline scaffold with good regioselectivity and good compatibility of functional groups. This strategy provides an alternative route to realize molecular complexity and diversity from simple and readily available molecules via multiple C-H bond activation. Preliminary mechanistic studies demonstrated that β,γ-dehydrogenation is triggered by the arylation of the C(sp)-H bond and the intramolecular C-N coupling.

Formation, structure and stability of high internal phase Pickering emulsions stabilized by BSPI-C3G covalent complexes.

Food-grade high internal phase Pickering emulsions (HIPPEs) are stabilized by protein-based particles, which have attracted extensive attention due to their good gel-like structure. The black soybean isolate protein/cyanidin-3-O-glucoside (BSPI-C3G) covalent particles were used as a particulate emulsifier to form stable HIPPEs with oil phase fractions (74 % v/v) and low particle concentrations (0.5 %-3 % w/v) The particle size distribution and microstructure demonstrated that the BSPI-C3G covalent particles acted as an interfacial layer and surrounded the oil droplets.

Integrated bioinformatics analysis uncovers characteristic genes and molecular subtyping system for endometriosis.

Endometriosis is a chronic inflammatory estrogen-dependent disease with the growth of endometrial tissues outside the uterine cavity. Nevertheless, the etiology of endometriosis is still unclear. Integrated bioinformatics analysis was implemented to reveal the molecular mechanisms underlying this disease.

MicroRNA-409-5p inhibits cell proliferation, and induces G/M phase arrest and apoptosis by targeting DLGAP5 in ovarian cancer cells.

MicroRNA (miRNA/miR)-409-5p has been reported to be implicated in prostate and breast cancers; however, its functional role in ovarian cancer (OC) remains unclear. Therefore the aim of the present study was to investigate the clinical significance and biological function of miR-409-5p in OC. Here, reverse transcription-quantitative PCR analysis was performed to detect miR-409-5p expression in OC tissues and cell lines.

Effect of Systemic Lidocaine on Postoperative Early Recovery Quality in Patients Undergoing Supratentorial Tumor Resection.

Purpose: Lidocaine has been gradually used in general anesthesia. This study was designed to investigate the effect of systemic lidocaine on postoperative quality of recovery (QoR) in patients undergoing supratentorial tumor resection, and to explore its brain-injury alleviation effect in neurosurgical anesthesia.

Patients And Methods: Sixty adult patients undergoing elective supratentorial tumor resection.

Design of a High-Sensitivity Dimeric G-Quadruplex/Hemin DNAzyme Biosensor for Norovirus Detection.

G-quadruplexes can bind with hemin to form peroxidase-like DNAzymes that are widely used in the design of biosensors. However, the catalytic activity of G-quadruplex/hemin DNAzyme is relatively low compared with natural peroxidase, which hampers its sensitivity and, thus, its application in the detection of nucleic acids. In this study, we developed a high-sensitivity biosensor targeting norovirus nucleic acids through rationally introducing a dimeric G-quadruplex structure into the DNAzyme.

Preliminary quantitative analysis of vertebral microenvironment changes in type 2 diabetes mellitus using FOCUS IVIM-DWI and IDEAL-IQ sequences.

Purpose: To explore the application of intravoxel incoherent motion diffusion-weighted imaging(IVIM-DWI) on account of field-of-view optimized and constrained undistorted single shot (FOCUS) and iteraterative decomposition of water and fat with echo asymmetry and least-squares estimation quantitation(IDEAL-IQ) sequences in evaluating the vertebral microenvironment changes of type 2 diabetes mellitus(T2DM) patients and the correlation with bone mineral density(BMD).

Method: 128 T2DM patients (mean age 63.4 ± 5.

Exploration of the Structure and Recognition of a G-quadruplex in the her2 Proto-oncogene Promoter and Its Transcriptional Regulation.

G-quadruplexes in oncogene promoters provide putative targets for transcriptional regulation. The structure of a putative G-quadruplex sequence (S1: GGAGAAGGAGGAGGTGGAGGAGGAGGG) in potassium solution in the her2 promoter has been resolved mainly through nuclear magnetic resonance (NMR) spectroscopy. By application of various NMR spectra, we proved the formation of a four-layer G-quadruplex composing of two G-tetrads and two G/A-mixed planes with a four-residues loop (A3-G4-A5-A6).

Non-Canonical G-quadruplexes cause the hCEB1 minisatellite instability in .

G-quadruplexes (G4) are polymorphic four-stranded structures formed by certain G-rich nucleic acids in vitro, but the sequence and structural features dictating their formation and function in vivo remains uncertain. Here we report a structure-function analysis of the complex hCEB1 G4-forming sequence. We isolated four G4 conformations in vitro, all of which bear unusual structural features: bears a V-shaped loop and a snapback guanine; contains a terminal G-triad; bears a zero-nucleotide loop; and is a zero-nucleotide loop monomer or an interlocked dimer.

ESI mass spectrometric exploration of selective recognition of G-quadruplex in c-myb oncogene promoter using a novel flexible cyclic polyamide.

In this research, electrospray ionization mass spectrometry (ESI-MS) was used to probe the binding selectivity of a flexible cyclic polyamide (cβ) to G-quadruplexes from the long G-rich sequences in the c-myb oncogene promoter. The results show that three G-rich sequences, including d[(GGA)3GGTCAC(GGA)4], d[(GGA)4GAA(GGA)4], and d[(GGA)3GGTCAC(GGA)4GAA(GGA)4] species in the c-myb promoter can form parallel G-quadruplexes, and cβ selectively binds towards these G-quadruplexes over both several other G-quadruplexes and the duplex DNA. These properties of cβ have profound implications on future studies of the regulation of c-myb oncogene expression.

Exploring the formation and recognition of an important G-quadruplex in a HIF1α promoter and its transcriptional inhibition by a benzo[c]phenanthridine derivative.

Four putative G-quadruplex sequences (PGSs) in the HIF1α promoter and the 5'UTR were evaluated for their G-quadruplex-forming potential using ESI-MS, CD, FRET, DMS footprinting, and a polymerase stop assay. An important G-quadruplex (S1) has been proven to inhibit HIF1α transcription by blocking AP2 binding. A benzo[c]phenanthridine derivative was found to target the S1 G-quadruplex and induce its conformational conversion from antiparallel to parallel orientation.

Convenient method for the synthesis of a flexible cyclic polyamide for selective targeting of c-myb G-quadruplex DNA.

A convenient efficient method for synthesis of a flexible cyclic polyamide (cβ, 1) was developed through cyclodimerization. Electrospray ionization mass spectrometry and nuclear magnetic resonance results showed that 1 selectively binds to the c-myb G-quadruplex with high affinity, and there was no binding with the ILPR, bcl-2, and c-kit G-quadruplexes. This is the first time that a flexible cyclic polyamide was found to have high selectivity for the c-myb G-quadruplex.

Investigation of non-covalent interaction of natural flexible cyclic molecules with telomeric RNA G-quadruplexes by electrospray ionization mass spectrometry.

Rationale: Recently, human telomeric DNA was found to be transcribed into RNA transcripts composing of tandem repeats of r(UUAGGG) which can form G-quadruplex structures. Studies have shown that human telomeric RNA is associated with the telomerase activity in vitro. Finding high affinity small molecule ligands binding to the telomeric RNA G-quadruplex may facilitate the regulation of the telomerase activity.

Spectroscopic probing of recognition of the G-quadruplex in c-kit promoter by small-molecule natural products.

The c-kit oncogene plays important roles in cell growth and proliferation which is associated with many human tumors. In this study, electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy were used to evaluate the formation and recognition of the G-quadruplex by d(AGGGAGGGCGCTGGGAGGAGGG) in the promoter region of the c-kit oncogene. Among the twelve small natural molecules studied, three crescent-shaped small molecules (chelerythrine, jatrorrhizine and berberine, named as P1-P3) and one flexible cyclic small molecule (fangchinoline, named as P4) were found to bind to the G-quadruplex with high affinities.

The formation and stabilization of a novel G-quadruplex in the 5'-flanking region of the relaxin gene.

It has been reported that binding of STAT3 protein to the 5'-flanking region of the relaxin gene may result in downregulation of the relaxin expression. There is a Guanine(G)-rich segment located in about 3.8 Kb upstream of the relaxin gene and very close to the STAT3's binding site.

Formation and recognition of G-quadruplex in promoter of c-myb oncogene by electrospray ionization mass spectrometry.

In this study, electrospray ionization mass spectrometry (ESI-MS) is used to study the formation of G-quadruplex by d(GGAGGAGGAGGA) which locates at the promoter region of c-myb gene. In addition, a natural small molecule, dehydrocorydaline from a Chinese herb, is found to have the highest binding affinity with the G-quadruplex in nine natural small molecules studied, and the binding selectivity of this natural molecule toward the c-myb G-quadruplex with respect to corresponding duplex DNA is significantly higher than that of the broad-spectrum G-quadruplex-ligand TMPyP4. The result from ESI-MS indicates that the gas-phase kinetic stability of the G-quadruplex can be enhanced by binding of dehydrocorydaline.

Electrophysiological response patterns of 16 olfactory neurons from the trichoid sensilla to odorant from fecal volatiles in the locust, locusta migratoria manilensis.

Locusts are the most serious pests of crops in greater part of the world. They locate their host plants primarily through olfactory cues, using antennal chemosensilla, which house olfactory receptor neurons (ORNs). Despite the great economical interest of these species, their olfactory neurons have been poorly investigated at the functional level.

New isoforms of odorant-binding proteins and potential semiochemicals of locusts.

To obtain more information on the elements of chemical communication in the migratory locust (Locusta migratoria) (Orthoptera: Acrididae), we have searched for additional odorant-binding proteins (OBPs) and for volatiles in the feces that could represent potential semiochemicals for this species. A two-dimensional electrophoretic (2DE) analysis of an antennal extract showed only three closely positioned spots that were recognized by the antiserum against locust OBP. Three genes were also identified using PCR and 5'RACE-PCR approaches, encoding isoforms differing from each other for a single amino acid substitution.

Solid substrate-room temperature phosphorescence method for the determination of trace Mn(II) based on oxidizing reaction of hydrogen peroxide using alpha,alpha'-bipyridine as sensitizer.

A new solid substrate-room temperature phosphorescence (SS-RTP) method for the determination of trace manganese (II) has been established. It bases on the fact that fullerol (R) emits strong and stable room temperature phosphorescence (RTP) on filter paper substrate. H2O2 can oxidize R to cause the SS-RTP quenching.