Correction: Nitrosothiol-Trapping-Based Proteomic Analysis of S-Nitrosylation in Human Lung Carcinoma Cells.

[This corrects the article DOI: 10.1371/journal.pone.

Nitrosothiol-Trapping-Based Proteomic Analysis of S-Nitrosylation in Human Lung Carcinoma Cells.

Nitrosylation of cysteines residues (S-nitrosylation) mediates many of the cellular effects of nitric oxide in normal and diseased cells. Recent research indicates that S-nitrosylation of certain proteins could play a role in tumor progression and responsiveness to therapy. However, the protein targets of S-nitrosylation in cancer cells remain largely unidentified.

Thioredoxin-mimetic peptides as catalysts of S-denitrosylation and anti-nitrosative stress agents.

S-nitrosylation, the coupling of a nitric oxide moiety to a reactive cysteine residue to form an S-nitrosothiol (SNO), is an important posttranslational mechanism for regulating protein activity. Growing evidence indicates that hyper-S-nitrosylation may contribute to cellular dysfunction associated with various human diseases. It is also increasingly appreciated that thioredoxin and thioredoxin reductase play significant roles in the cellular catabolism of SNO and protection from nitrosative stress.

Suppression of the pro-inflammatory NLRP3/interleukin-1β pathway in macrophages by the thioredoxin reductase inhibitor auranofin.

Background: The thioredoxin/thioredoxin reductase system, which is best known for its essential role in antioxidant defense and redox homeostasis, is increasingly implicated in the regulation of multiple cellular signaling pathways. In the present study, we asked if the thioredoxin system in macrophages might regulate toll-like receptor 4 (TLR4)-dependent gene expression and consequent responses.

Methods: Using microarray analysis we analyzed the effect of auranofin, a highly potent and specific inhibitor of thioredoxin reductase, on the transcriptional program activated in J774 macrophages by the TLR4 agonist, lipopolysaccharide (LPS).

A substrate trapping approach identifies proteins regulated by reversible S-nitrosylation.

Protein S-nitrosylation, the nitric oxide-mediated posttranslational modification of cysteine residues, has emerged as an important regulatory mechanism in diverse cellular processes. Yet, knowledge about the S-nitrosoproteome in different cell types and cellular contexts is still limited and many questions remain regarding the precise roles of protein S-nitrosylation and denitrosylation. Here we present a novel strategy to identify reversibly nitrosylated proteins.

Multilevel regulation of 2-Cys peroxiredoxin reaction cycle by S-nitrosylation.

S-nitrosothiols (SNOs), formed by nitric oxide (NO)-mediated S-nitrosylation, and hydrogen peroxide (H2O2), a prominent reactive oxygen species, are implicated in diverse physiological and pathological processes. Recent research has shown that the cellular action and metabolism of SNOs and H2O2 involve overlapping, thiol-based mechanisms, but how these reactive species may affect each other's fate and function is not well understood. In this study we investigated how NO/SNO may affect the redox cycle of mammalian peroxiredoxin-1 (Prx1), a representative of the 2-Cys Prxs, a group of thioredoxin (Trx)-dependent peroxidases.

Quadruplex structures of muscle gene promoter sequences enhance in vivo MyoD-dependent gene expression.

Gene promoters are enriched in guanine clusters that potentially fold into quadruplex structures. Such quadruplexes were implicated in the regulation of gene expression, plausibly by interacting with transcription factors. We showed previously that homodimers of the myogenic transcription factor MyoD bound in vitro most tightly bimolecular quadruplexes of promoter sequences of muscle-specific genes.

The quadruplex r(CGG)n destabilizing cationic porphyrin TMPyP4 cooperates with hnRNPs to increase the translation efficiency of fragile X premutation mRNA.

The 5' untranslated region of the FMR1 gene which normally includes 4-55 d(CGG) repeats expands to > 55-200 repeats in carriers of fragile X syndrome premutation. Although the levels of premutation FMR1 mRNA in carrier cells are 5-10-fold higher than normal, the amount of the product FMR protein is unchanged or reduced. We demonstrated previously that premutation r(CGG)(n) tracts formed quadruplex structures that impeded translation and lowered the efficiency of protein synthesis.

Differential binding of quadruplex structures of muscle-specific genes regulatory sequences by MyoD, MRF4 and myogenin.

Four myogenic regulatory factors (MRFs); MyoD, Myf-5, MRF4 and Myogenin direct muscle tissue differentiation. Heterodimers of MRFs with E-proteins activate muscle-specific gene expression by binding to E-box motifs d(CANNTG) in their promoters or enhancers. We showed previously that in contrast to the favored binding of E-box by MyoD-E47 heterodimers, homodimeric MyoD associated preferentially with quadruplex structures of regulatory sequences of muscle-specific genes.

MyoD uses overlapping but distinct elements to bind E-box and tetraplex structures of regulatory sequences of muscle-specific genes.

Muscle differentiation and expression of muscle-specific proteins are initiated by the binding of heterodimers of the transcription factor MyoD with E2A proteins to E-box motif d(CANNTG) in promoters or enhancers of muscle-specific genes. MyoD homodimers, however, form tighter complexes with tetraplex structures of guanine-rich regulatory sequences of some muscle genes. In this work, we identified elements in MyoD that bind E-box or tetraplex structures of promoter sequences of the muscle-specific genes alpha7 integrin and sarcomeric Mitochondrial Creatine Kinase (sMtCK).

The tetraplex (CGG)n destabilizing proteins hnRNP A2 and CBF-A enhance the in vivo translation of fragile X premutation mRNA.

Expansion of a (CGG)n sequence in the 5'-UTR of the FMR1 gene to >200-2000 repeats abolishes its transcription and initiates fragile X syndrome (FXS). By contrast, levels of FMR1 mRNA are 5-10-fold higher in FXS premutation carriers of >55-200 repeats than in normal subjects. Lack of a corresponding increase in the amount of the product FMRP protein in carrier cells suggest that (CGG)>55-200 tracts thwart translation.

Homodimeric MyoD preferentially binds tetraplex structures of regulatory sequences of muscle-specific genes.

Myogenic transcription is activated by the binding of heterodimers of the basic helix-loop-helix proteins MyoD and E12 or E47 to a consensus E-box sequence, d(CANNTG), in promoter or enhancer regions of muscle-specific genes. Homodimers of MyoD bind E-box less tightly and are less efficient activators of transcription. Recent results from our laboratory (Yafe, A.

Formation and properties of hairpin and tetraplex structures of guanine-rich regulatory sequences of muscle-specific genes.

Clustered guanine residues in DNA readily generate hairpin or a variety of tetrahelical structures. The myogenic determination protein MyoD was reported to bind to a tetrahelical structure of guanine-rich enhancer sequence of muscle creatine kinase (MCK) more tightly than to its target E-box motif [K. Walsh and A.

Destabilization of tetraplex structures of the fragile X repeat sequence (CGG)n is mediated by homolog-conserved domains in three members of the hnRNP family.

Hairpin or tetrahelical structures formed by a d(CGG)n sequence in the FMR1 gene are thought to promote expansion of the repeat tract. Subsequent to this expansion FMR1 is silenced and fragile X syndrome ensues. The injurious effects of d(CGG)n secondary structures may potentially be countered by agents that act to decrease their stability.

The cationic porphyrin TMPyP4 destabilizes the tetraplex form of the fragile X syndrome expanded sequence d(CGG)n.

Fragile X syndrome, the most common cause of inherited mental retardation, is instigated by dynamic expansion of a d(CGG) trinucleotide repeat in the 5'-untranslated region of the first exon of the FMR1 gene, resulting in its silencing. The expanded d(CGG)(n) tract readily folds into hairpin and tetraplex structures which may contribute to the blocking of FMR1 transcription. In this work, we report that the cationic porphyrin 5,10,15,20-tetra(N-methyl-4-pyridyl)porphin (TMPyP4) effectively destabilizes in vitro the G'2 bimolecular tetraplex structure of d(CGG)(n) while it stabilizes the G'2 tetraplex form of the telomeric sequence d(TTAGGG)(2).

Distinct domains in the CArG-box binding factor A destabilize tetraplex forms of the fragile X expanded sequence d(CGG)n.

Formation of hairpin or tetraplex structures of the FMR1 gene d(CGG)n sequence triggers its expansion, setting off fragile X syndrome. In searching for proteins that destabilize d(CGG)n secondary structures we purified from rat liver quadruplex telomeric DNA binding protein 42 (qTBP42) that disrupts G'2 bimolecular tetraplex d(CGG)n while paradoxically stabilizing the G'2 structure of the telomeric sequence d(TTAGGG)n. Based on peptide sequence homology of qTBP42 and mouse CArG-box binding factor A (CBF-A), we provide direct evidence that recombinant CBF-A protein is physically and immunochemically indistinguishable from qTBP42 and that it too destabilizes G'2 d(CGG)n while stabilizing G'2 d(TTAGGG)n.

Human Ku antigen tightly binds and stabilizes a tetrahelical form of the Fragile X syndrome d(CGG)n expanded sequence.

Hairpin and tetrahelical structures of a d(CGG)(n) sequence in the FMR1 gene have been implicated in its expansion in fragile X syndrome. The identification of tetraplex d(CGG)(n) destabilizing proteins (Fry, M., and Loeb, L.

Interruption of the fragile X syndrome expanded sequence d(CGG)(n) by interspersed d(AGG) trinucleotides diminishes the formation and stability of d(CGG)(n) tetrahelical structures.

Fragile X syndrome is caused by expansion of a d(CGG) trinucleotide repeat sequence in the 5' untranslated region of the first exon of the FMR1 gene. Repeat expansion is thought to be instigated by formation of d(CGG)(n)secondary structures. Stable FMR1 d(CGG)(n)runs in normal individuals consist of 6-52 d(CGG) repeats that are interrupted every 9-11 triplets by a single d(AGG) trinucleotide.

Tetrahelical forms of the fragile X syndrome expanded sequence d(CGG)(n) are destabilized by two heterogeneous nuclear ribonucleoprotein-related telomeric DNA-binding proteins.

Formations of hairpin and tetrahelical structures by the trinucleotide repeat sequence d(CGG)(n) might contribute to its expansion in fragile X syndrome. Here we show that tetraplex structures of d(CGG)(n) are destabilized by two mammalian heterogeneous nuclear ribonucleoprotein-related tetraplex telomeric DNA-binding and -stabilizing proteins, quadruplex telomeric DNA-binding protein 42 (qTBP42) (Sarig, G., Weisman-Shomer, P.

Telomeric and tetraplex DNA binding properties of qTBP42: a homologue of the CArG box binding protein CBF-A.

qTBP42, a rat liver binding protein of telomeric and of guanine-rich single stranded or tetraplex DNA (Sarig, G., Weisman-Shomer, P., Erlitzki, R.

Purification and characterization of qTBP42, a new single-stranded and quadruplex telomeric DNA-binding protein from rat hepatocytes.

Telomeres of vertebrate chromosomes terminate with a short 5'-d(TTAGGG)-3' single-stranded overhang that can form in vitro tetrahelical structures. Here we describe a new protein from rat hepatocyte nuclei designated quadruplex telomere-binding protein 42 (qTBP42) that tightly binds 5'-d(TTAGGG)n-3' and 5'-d(CCCTAA)n-3' single-stranded and tetraplex forms of 5'd(TTAGGG)n-3'. The thermostable qTBP42 was isolated from boiled nuclear extracts and purified to near homogeneity by successive steps of column chromatography on DEAE-cellulose, phosphocellulose, and phenyl-Sepharose.

The fragile X syndrome single strand d(CGG)n nucleotide repeats readily fold back to form unimolecular hairpin structures.

Expansion of a d(CGG)n run within the 5'-untranslated region of the X-linked human gene FMR1 blocks FMR1 transcription, delays its replication, and precipitates the fragile X syndrome. We showed previously that d(CGG)n tracts aggregate into interstrand tetrahelical complexes (Fry, M., and Loeb, L.

Stabilization of tetrahelical DNA by the quadruplex DNA binding protein QUAD.

The 57-kDa hepatic nuclear protein QUAD binds tightly and specifically a parallel tetrahelical form of the IgG switch region DNA (Weisman-Shomer, P. and Fry, M. (1993) J.

QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA.

The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366).

Sequence specificity of pausing by DNA polymerases.

We have constructed recombinant M13 DNA templates containing stretches of oligo (purines) and oligo (pyrimidines). Each of these inserts hinders the advancement of the large fragment of E. coli Pol I during DNA synthesis.